FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629887_at:

>probe:Drosophila_2:1629887_at:482:499; Interrogation_Position=1720; Antisense; GTCTGCACTCGGACCTATCGAAGTA
>probe:Drosophila_2:1629887_at:112:401; Interrogation_Position=1731; Antisense; GACCTATCGAAGTACGGCCCGTGGG
>probe:Drosophila_2:1629887_at:336:605; Interrogation_Position=1762; Antisense; TGATGCTCGGCATGCTCCTGTGCGG
>probe:Drosophila_2:1629887_at:660:115; Interrogation_Position=1828; Antisense; AGCATGCGGTCAACAACGAGCGGGA
>probe:Drosophila_2:1629887_at:352:633; Interrogation_Position=1914; Antisense; TCGCCGCCCAACTATGAAGAGCTGG
>probe:Drosophila_2:1629887_at:442:681; Interrogation_Position=1926; Antisense; TATGAAGAGCTGGATCCGCCGCCGG
>probe:Drosophila_2:1629887_at:723:637; Interrogation_Position=1956; Antisense; TCGGTGCTCTTTCCCAACCAAAAGG
>probe:Drosophila_2:1629887_at:672:157; Interrogation_Position=1995; Antisense; ACACTGAACCTGGATGCCACGGCGG
>probe:Drosophila_2:1629887_at:298:75; Interrogation_Position=2102; Antisense; AGGAGCAACACCCAGCGATTCCGCG
>probe:Drosophila_2:1629887_at:357:73; Interrogation_Position=2143; Antisense; AGGAACAGCCAACGAACTAGCCCGT
>probe:Drosophila_2:1629887_at:191:385; Interrogation_Position=2156; Antisense; GAACTAGCCCGTAAGCCTGACAAGA
>probe:Drosophila_2:1629887_at:683:313; Interrogation_Position=2170; Antisense; GCCTGACAAGAAGGTGTCGCACCTG
>probe:Drosophila_2:1629887_at:14:199; Interrogation_Position=2198; Antisense; AACGTAGATCTTAAGGTCCCAACAT
>probe:Drosophila_2:1629887_at:281:39; Interrogation_Position=2221; Antisense; ATCTCTCTGACTGACTCTGATGCAA

Paste this into a BLAST search page for me
GTCTGCACTCGGACCTATCGAAGTAGACCTATCGAAGTACGGCCCGTGGGTGATGCTCGGCATGCTCCTGTGCGGAGCATGCGGTCAACAACGAGCGGGATCGCCGCCCAACTATGAAGAGCTGGTATGAAGAGCTGGATCCGCCGCCGGTCGGTGCTCTTTCCCAACCAAAAGGACACTGAACCTGGATGCCACGGCGGAGGAGCAACACCCAGCGATTCCGCGAGGAACAGCCAACGAACTAGCCCGTGAACTAGCCCGTAAGCCTGACAAGAGCCTGACAAGAAGGTGTCGCACCTGAACGTAGATCTTAAGGTCCCAACATATCTCTCTGACTGACTCTGATGCAA

Full Affymetrix probeset data:

Annotations for 1629887_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720