FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629888_at:

>probe:Drosophila_2:1629888_at:136:315; Interrogation_Position=1001; Antisense; GCCTTCCATCTGCACTTTAGGAATA
>probe:Drosophila_2:1629888_at:447:241; Interrogation_Position=1022; Antisense; AATACGCCGATGTGCCCGGAGCTGA
>probe:Drosophila_2:1629888_at:525:205; Interrogation_Position=1049; Antisense; AAGCTGCAGGTGCACTCACTGGCTC
>probe:Drosophila_2:1629888_at:694:313; Interrogation_Position=1089; Antisense; GCCATTCGGACAGCGGCATCATTAT
>probe:Drosophila_2:1629888_at:582:569; Interrogation_Position=1103; Antisense; GGCATCATTATGGAGTTCTGGAACA
>probe:Drosophila_2:1629888_at:619:153; Interrogation_Position=1125; Antisense; ACAGAGTGGACCGACACATGGCCGT
>probe:Drosophila_2:1629888_at:157:49; Interrogation_Position=1152; Antisense; ATGCCCGTCAGTTTGCGTTTATCTG
>probe:Drosophila_2:1629888_at:658:77; Interrogation_Position=1182; Antisense; AGTAGGGTTCTTGTGATTACATTCC
>probe:Drosophila_2:1629888_at:260:301; Interrogation_Position=1206; Antisense; CCCCTGGCGCACATACATACATAGA
>probe:Drosophila_2:1629888_at:304:437; Interrogation_Position=752; Antisense; GAGGAGTTGCACTACGAGCCAGAGC
>probe:Drosophila_2:1629888_at:121:517; Interrogation_Position=805; Antisense; GTGTCGGCCCAAGGAGGTCATAGTC
>probe:Drosophila_2:1629888_at:21:199; Interrogation_Position=845; Antisense; AACGAGCTTGTTAGCTACCGGGTCA
>probe:Drosophila_2:1629888_at:117:91; Interrogation_Position=857; Antisense; AGCTACCGGGTCATCGACAACGTGA
>probe:Drosophila_2:1629888_at:547:127; Interrogation_Position=885; Antisense; ACCTAACACCCGTCGAATGGGATCG

Paste this into a BLAST search page for me
GCCTTCCATCTGCACTTTAGGAATAAATACGCCGATGTGCCCGGAGCTGAAAGCTGCAGGTGCACTCACTGGCTCGCCATTCGGACAGCGGCATCATTATGGCATCATTATGGAGTTCTGGAACAACAGAGTGGACCGACACATGGCCGTATGCCCGTCAGTTTGCGTTTATCTGAGTAGGGTTCTTGTGATTACATTCCCCCCTGGCGCACATACATACATAGAGAGGAGTTGCACTACGAGCCAGAGCGTGTCGGCCCAAGGAGGTCATAGTCAACGAGCTTGTTAGCTACCGGGTCAAGCTACCGGGTCATCGACAACGTGAACCTAACACCCGTCGAATGGGATCG

Full Affymetrix probeset data:

Annotations for 1629888_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720