Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629889_s_at:

>probe:Drosophila_2:1629889_s_at:479:119; Interrogation_Position=1021; Antisense; AGCTGCAATCTCTATCTATCCTTAG
>probe:Drosophila_2:1629889_s_at:44:519; Interrogation_Position=573; Antisense; GTGGGCATCTCCAATGGACTGGCAT
>probe:Drosophila_2:1629889_s_at:716:373; Interrogation_Position=614; Antisense; GAAGTTCTACTACATCGATACCACC
>probe:Drosophila_2:1629889_s_at:41:147; Interrogation_Position=661; Antisense; ACTATGATTTCGAGACCGGCGTGGC
>probe:Drosophila_2:1629889_s_at:54:331; Interrogation_Position=679; Antisense; GCGTGGCTAGCAATCCCAAGGTTAT
>probe:Drosophila_2:1629889_s_at:438:223; Interrogation_Position=696; Antisense; AAGGTTATATTCAATCTGCGCAAGA
>probe:Drosophila_2:1629889_s_at:541:25; Interrogation_Position=721; Antisense; ATAGTCCCAAGGATCATCTGCTGCC
>probe:Drosophila_2:1629889_s_at:350:609; Interrogation_Position=754; Antisense; TGACCATCGATACCGAGGGCAACCT
>probe:Drosophila_2:1629889_s_at:143:83; Interrogation_Position=769; Antisense; AGGGCAACCTGTATGTGGCCACCTT
>probe:Drosophila_2:1629889_s_at:393:541; Interrogation_Position=815; Antisense; GGTTAATCCCAACACTGGCAAGATT
>probe:Drosophila_2:1629889_s_at:417:343; Interrogation_Position=842; Antisense; GCTTGAGATCAAGTTCCCAACCAAA
>probe:Drosophila_2:1629889_s_at:295:191; Interrogation_Position=897; Antisense; AACTTGGACATCCTGTACGTGACCA
>probe:Drosophila_2:1629889_s_at:654:159; Interrogation_Position=964; Antisense; ACAAGGTGACCGGACTGAACGCCAC
>probe:Drosophila_2:1629889_s_at:670:43; Interrogation_Position=994; Antisense; ATCCCGGCGTCAACCTGAAGGTCTA

Paste this into a BLAST search page for me
AGCTGCAATCTCTATCTATCCTTAGGTGGGCATCTCCAATGGACTGGCATGAAGTTCTACTACATCGATACCACCACTATGATTTCGAGACCGGCGTGGCGCGTGGCTAGCAATCCCAAGGTTATAAGGTTATATTCAATCTGCGCAAGAATAGTCCCAAGGATCATCTGCTGCCTGACCATCGATACCGAGGGCAACCTAGGGCAACCTGTATGTGGCCACCTTGGTTAATCCCAACACTGGCAAGATTGCTTGAGATCAAGTTCCCAACCAAAAACTTGGACATCCTGTACGTGACCAACAAGGTGACCGGACTGAACGCCACATCCCGGCGTCAACCTGAAGGTCTA

Full Affymetrix probeset data:

Annotations for 1629889_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime