Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629890_a_at:

>probe:Drosophila_2:1629890_a_at:590:433; Interrogation_Position=1022; Antisense; GAGGTTATGTACACCGAACTCAAGT
>probe:Drosophila_2:1629890_a_at:85:653; Interrogation_Position=1041; Antisense; TCAAGTCGGCTGCTGAATCGGGTAC
>probe:Drosophila_2:1629890_a_at:2:347; Interrogation_Position=626; Antisense; GAGTACCGCTACTGGGAATCGTTTT
>probe:Drosophila_2:1629890_a_at:161:237; Interrogation_Position=642; Antisense; AATCGTTTTGGATCATTCGCGGCTT
>probe:Drosophila_2:1629890_a_at:526:539; Interrogation_Position=724; Antisense; GGTTCAGCAGTACGGCTTTGTGCCT
>probe:Drosophila_2:1629890_a_at:630:311; Interrogation_Position=756; Antisense; GCCGGATATACTGCTCGGGTCGATC
>probe:Drosophila_2:1629890_a_at:241:201; Interrogation_Position=782; Antisense; AACCCTCCACTCTTGATCATGATGG
>probe:Drosophila_2:1629890_a_at:664:555; Interrogation_Position=832; Antisense; GGACGAGCAGTACGCCATTGAAGCT
>probe:Drosophila_2:1629890_a_at:213:695; Interrogation_Position=856; Antisense; TTTGCCGCTGCTGGAAACCGAATAC
>probe:Drosophila_2:1629890_a_at:438:457; Interrogation_Position=881; Antisense; GATACCTTCATCAGCAAGCACTCGG
>probe:Drosophila_2:1629890_a_at:543:81; Interrogation_Position=915; Antisense; AGGGCAGGACCATGTATCAGTATCG
>probe:Drosophila_2:1629890_a_at:440:35; Interrogation_Position=930; Antisense; ATCAGTATCGGGATTCCTCGGCAGG
>probe:Drosophila_2:1629890_a_at:211:71; Interrogation_Position=959; Antisense; AGGCCCGAGGCCTATCGAGAAGATC
>probe:Drosophila_2:1629890_a_at:529:207; Interrogation_Position=997; Antisense; AAGCATCAAGAGTCCTGTGGTCCGA

Paste this into a BLAST search page for me
GAGGTTATGTACACCGAACTCAAGTTCAAGTCGGCTGCTGAATCGGGTACGAGTACCGCTACTGGGAATCGTTTTAATCGTTTTGGATCATTCGCGGCTTGGTTCAGCAGTACGGCTTTGTGCCTGCCGGATATACTGCTCGGGTCGATCAACCCTCCACTCTTGATCATGATGGGGACGAGCAGTACGCCATTGAAGCTTTTGCCGCTGCTGGAAACCGAATACGATACCTTCATCAGCAAGCACTCGGAGGGCAGGACCATGTATCAGTATCGATCAGTATCGGGATTCCTCGGCAGGAGGCCCGAGGCCTATCGAGAAGATCAAGCATCAAGAGTCCTGTGGTCCGA

Full Affymetrix probeset data:

Annotations for 1629890_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime