FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629894_at:

>probe:Drosophila_2:1629894_at:244:169; Interrogation_Position=1001; Antisense; AAATGTGGCCAACTGGGCTTCACCA
>probe:Drosophila_2:1629894_at:711:177; Interrogation_Position=1069; Antisense; AAACTTGTCCTACGATGCCGAGAGC
>probe:Drosophila_2:1629894_at:615:317; Interrogation_Position=1085; Antisense; GCCGAGAGCTGTTCGCCATATTTGA
>probe:Drosophila_2:1629894_at:693:19; Interrogation_Position=1104; Antisense; ATTTGAGCGCTCTGCAGGAGTGGAT
>probe:Drosophila_2:1629894_at:663:33; Interrogation_Position=1140; Antisense; ATCAAACGAGTATCGCCTGCAAGGC
>probe:Drosophila_2:1629894_at:405:165; Interrogation_Position=1175; Antisense; AAATCCCTCAATCTGGGTGGCGTCA
>probe:Drosophila_2:1629894_at:483:521; Interrogation_Position=1191; Antisense; GTGGCGTCATGGTCTTCTCGCTGAA
>probe:Drosophila_2:1629894_at:464:643; Interrogation_Position=1206; Antisense; TCTCGCTGAACACCGATGATCTCAA
>probe:Drosophila_2:1629894_at:347:325; Interrogation_Position=1266; Antisense; GCGAGAAACCTGTATTTCCGCTAAC
>probe:Drosophila_2:1629894_at:45:339; Interrogation_Position=1285; Antisense; GCTAACCCAGGCCATTAAGGACATC
>probe:Drosophila_2:1629894_at:443:527; Interrogation_Position=1314; Antisense; GGGAGTCCCTGTGATTACTTTGTAT
>probe:Drosophila_2:1629894_at:693:373; Interrogation_Position=1361; Antisense; GAAGAGGCTGTTGCTTCTGCTGGCT
>probe:Drosophila_2:1629894_at:21:373; Interrogation_Position=1511; Antisense; GAAGGTGTCAGCATACGCAAATCAT
>probe:Drosophila_2:1629894_at:285:165; Interrogation_Position=964; Antisense; AAATCATCGCATAGGAGCTCCTGCT

Paste this into a BLAST search page for me
AAATGTGGCCAACTGGGCTTCACCAAAACTTGTCCTACGATGCCGAGAGCGCCGAGAGCTGTTCGCCATATTTGAATTTGAGCGCTCTGCAGGAGTGGATATCAAACGAGTATCGCCTGCAAGGCAAATCCCTCAATCTGGGTGGCGTCAGTGGCGTCATGGTCTTCTCGCTGAATCTCGCTGAACACCGATGATCTCAAGCGAGAAACCTGTATTTCCGCTAACGCTAACCCAGGCCATTAAGGACATCGGGAGTCCCTGTGATTACTTTGTATGAAGAGGCTGTTGCTTCTGCTGGCTGAAGGTGTCAGCATACGCAAATCATAAATCATCGCATAGGAGCTCCTGCT

Full Affymetrix probeset data:

Annotations for 1629894_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720