FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629896_at:

>probe:Drosophila_2:1629896_at:493:395; Interrogation_Position=1007; Antisense; GAAATCTAATAGTTCACTCTCAAGT
>probe:Drosophila_2:1629896_at:306:653; Interrogation_Position=1026; Antisense; TCAAGTGGATGAAACCTCGCGTCTA
>probe:Drosophila_2:1629896_at:485:175; Interrogation_Position=1037; Antisense; AAACCTCGCGTCTAGGCCAATATAT
>probe:Drosophila_2:1629896_at:453:611; Interrogation_Position=594; Antisense; TGACTTGGGCCCCTTGAGTCTTACA
>probe:Drosophila_2:1629896_at:645:607; Interrogation_Position=608; Antisense; TGAGTCTTACACAAACGCCTTTCGT
>probe:Drosophila_2:1629896_at:688:255; Interrogation_Position=619; Antisense; CAAACGCCTTTCGTCTTTGAGAGAA
>probe:Drosophila_2:1629896_at:529:439; Interrogation_Position=661; Antisense; GATGGCGAACTATCTGAGATTTTTC
>probe:Drosophila_2:1629896_at:606:267; Interrogation_Position=695; Antisense; CAGGTTATCACATCTTGTTGCGCAC
>probe:Drosophila_2:1629896_at:565:623; Interrogation_Position=713; Antisense; TGCGCACCCCGATTAACTACATTAA
>probe:Drosophila_2:1629896_at:420:137; Interrogation_Position=876; Antisense; ACGGCAATCACCAGTTTTCGAAAGT
>probe:Drosophila_2:1629896_at:53:215; Interrogation_Position=897; Antisense; AAGTATGTCTAGTTGTTCGGGTCGT
>probe:Drosophila_2:1629896_at:35:571; Interrogation_Position=921; Antisense; TGTGTTTTTTAAAGCTTCGTCCTCG
>probe:Drosophila_2:1629896_at:676:295; Interrogation_Position=944; Antisense; CGACTTCTGTGTCTGAGGCACCGAA
>probe:Drosophila_2:1629896_at:115:427; Interrogation_Position=970; Antisense; GAGAGTATCAAATTCGCAAGACATC

Paste this into a BLAST search page for me
GAAATCTAATAGTTCACTCTCAAGTTCAAGTGGATGAAACCTCGCGTCTAAAACCTCGCGTCTAGGCCAATATATTGACTTGGGCCCCTTGAGTCTTACATGAGTCTTACACAAACGCCTTTCGTCAAACGCCTTTCGTCTTTGAGAGAAGATGGCGAACTATCTGAGATTTTTCCAGGTTATCACATCTTGTTGCGCACTGCGCACCCCGATTAACTACATTAAACGGCAATCACCAGTTTTCGAAAGTAAGTATGTCTAGTTGTTCGGGTCGTTGTGTTTTTTAAAGCTTCGTCCTCGCGACTTCTGTGTCTGAGGCACCGAAGAGAGTATCAAATTCGCAAGACATC

Full Affymetrix probeset data:

Annotations for 1629896_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720