Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629899_at:

>probe:Drosophila_2:1629899_at:590:455; Interrogation_Position=1624; Antisense; GATACGAAGGTGAGCGTCACTGCTT
>probe:Drosophila_2:1629899_at:194:511; Interrogation_Position=1633; Antisense; GTGAGCGTCACTGCTTAAGAACATG
>probe:Drosophila_2:1629899_at:707:599; Interrogation_Position=1656; Antisense; TGTACCAAGAAAAGATCACTGCGAT
>probe:Drosophila_2:1629899_at:651:453; Interrogation_Position=1669; Antisense; GATCACTGCGATCGCGTAGAGCGTA
>probe:Drosophila_2:1629899_at:333:635; Interrogation_Position=1680; Antisense; TCGCGTAGAGCGTAAGACACAATTT
>probe:Drosophila_2:1629899_at:700:395; Interrogation_Position=1695; Antisense; GACACAATTTGAAATGGGCCACCAC
>probe:Drosophila_2:1629899_at:193:689; Interrogation_Position=1702; Antisense; TTTGAAATGGGCCACCACCAGCTTC
>probe:Drosophila_2:1629899_at:299:261; Interrogation_Position=1714; Antisense; CACCACCAGCTTCCAAAATGTTCAA
>probe:Drosophila_2:1629899_at:25:261; Interrogation_Position=1717; Antisense; CACCAGCTTCCAAAATGTTCAAAAA
>probe:Drosophila_2:1629899_at:587:551; Interrogation_Position=1754; Antisense; GGAGAAGAGAAGTACCCAGCTGAAC
>probe:Drosophila_2:1629899_at:457:89; Interrogation_Position=1764; Antisense; AGTACCCAGCTGAACTGGTATTCAG
>probe:Drosophila_2:1629899_at:565:381; Interrogation_Position=1775; Antisense; GAACTGGTATTCAGCGAGAAAAATA
>probe:Drosophila_2:1629899_at:325:21; Interrogation_Position=1797; Antisense; ATATTGTTACACTTGAGAAACTCTA
>probe:Drosophila_2:1629899_at:580:423; Interrogation_Position=1811; Antisense; GAGAAACTCTATTGTAACACAATGT

Paste this into a BLAST search page for me
GATACGAAGGTGAGCGTCACTGCTTGTGAGCGTCACTGCTTAAGAACATGTGTACCAAGAAAAGATCACTGCGATGATCACTGCGATCGCGTAGAGCGTATCGCGTAGAGCGTAAGACACAATTTGACACAATTTGAAATGGGCCACCACTTTGAAATGGGCCACCACCAGCTTCCACCACCAGCTTCCAAAATGTTCAACACCAGCTTCCAAAATGTTCAAAAAGGAGAAGAGAAGTACCCAGCTGAACAGTACCCAGCTGAACTGGTATTCAGGAACTGGTATTCAGCGAGAAAAATAATATTGTTACACTTGAGAAACTCTAGAGAAACTCTATTGTAACACAATGT

Full Affymetrix probeset data:

Annotations for 1629899_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime