FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629901_at:

>probe:Drosophila_2:1629901_at:372:553; Interrogation_Position=1581; Antisense; GGAGCAGCAGTGATCTCACCTCAGA
>probe:Drosophila_2:1629901_at:568:405; Interrogation_Position=1626; Antisense; GATCCCTTTACACCCTTGAGTGGTA
>probe:Drosophila_2:1629901_at:227:433; Interrogation_Position=1653; Antisense; GAGTGCACCCGAATTGAGCGCATTC
>probe:Drosophila_2:1629901_at:655:179; Interrogation_Position=1691; Antisense; AAACAACACTTCACTGATCGCCAAG
>probe:Drosophila_2:1629901_at:302:417; Interrogation_Position=1715; Antisense; GAGCGCTGCGGTTATAAAGGTCCTG
>probe:Drosophila_2:1629901_at:630:655; Interrogation_Position=1760; Antisense; TAATCTTAGCACCTCGCCATCTGGA
>probe:Drosophila_2:1629901_at:282:41; Interrogation_Position=1778; Antisense; ATCTGGACGCCTAGATGCACTGGTT
>probe:Drosophila_2:1629901_at:277:51; Interrogation_Position=1792; Antisense; ATGCACTGGTTCCACATACCGAGAG
>probe:Drosophila_2:1629901_at:310:425; Interrogation_Position=1812; Antisense; GAGAGCCACCAGCAAGATGTCGCGC
>probe:Drosophila_2:1629901_at:496:139; Interrogation_Position=1838; Antisense; ACGTCTTCAGCTCAACGACAGAACA
>probe:Drosophila_2:1629901_at:38:233; Interrogation_Position=1866; Antisense; AATGACTCACTGCAGCTTGATCCCG
>probe:Drosophila_2:1629901_at:582:385; Interrogation_Position=1976; Antisense; GAACATCAGCGATAGCGTGCTCAAG
>probe:Drosophila_2:1629901_at:466:457; Interrogation_Position=2001; Antisense; GATATTATCTTTTAGTCCACGGGAA
>probe:Drosophila_2:1629901_at:82:141; Interrogation_Position=2019; Antisense; ACGGGAATCGCGAATGGCCAATATT

Paste this into a BLAST search page for me
GGAGCAGCAGTGATCTCACCTCAGAGATCCCTTTACACCCTTGAGTGGTAGAGTGCACCCGAATTGAGCGCATTCAAACAACACTTCACTGATCGCCAAGGAGCGCTGCGGTTATAAAGGTCCTGTAATCTTAGCACCTCGCCATCTGGAATCTGGACGCCTAGATGCACTGGTTATGCACTGGTTCCACATACCGAGAGGAGAGCCACCAGCAAGATGTCGCGCACGTCTTCAGCTCAACGACAGAACAAATGACTCACTGCAGCTTGATCCCGGAACATCAGCGATAGCGTGCTCAAGGATATTATCTTTTAGTCCACGGGAAACGGGAATCGCGAATGGCCAATATT

Full Affymetrix probeset data:

Annotations for 1629901_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720