Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629902_at:

>probe:Drosophila_2:1629902_at:142:443; Interrogation_Position=3165; Antisense; GATGTGACGCAATCTGCTGCCATAA
>probe:Drosophila_2:1629902_at:402:485; Interrogation_Position=3195; Antisense; GTAGACGCTACTGAAACTCCAAAGG
>probe:Drosophila_2:1629902_at:226:5; Interrogation_Position=3279; Antisense; ATTGTGGGAATACGTCACCTGCGTC
>probe:Drosophila_2:1629902_at:589:657; Interrogation_Position=3316; Antisense; TAAGCCATTCAGATGCCGAGAGTTT
>probe:Drosophila_2:1629902_at:710:429; Interrogation_Position=3335; Antisense; GAGTTTATTAGGACCGCAGTCGCCC
>probe:Drosophila_2:1629902_at:530:563; Interrogation_Position=3368; Antisense; GGAATCCACTGAGTCTGAAGCGGTA
>probe:Drosophila_2:1629902_at:201:163; Interrogation_Position=3407; Antisense; AAATTTACGCCAGCCGCAAATGAGA
>probe:Drosophila_2:1629902_at:339:57; Interrogation_Position=3426; Antisense; ATGAGACGTCGCCTCGAAATGGCAA
>probe:Drosophila_2:1629902_at:316:393; Interrogation_Position=3441; Antisense; GAAATGGCAATTGCCCGGTCGTCGA
>probe:Drosophila_2:1629902_at:600:179; Interrogation_Position=3539; Antisense; AAACAAGGCTTTCCGGCGCAACATG
>probe:Drosophila_2:1629902_at:346:65; Interrogation_Position=3561; Antisense; ATGGACGAGCGTTTCAGCCGAGTTA
>probe:Drosophila_2:1629902_at:445:125; Interrogation_Position=3576; Antisense; AGCCGAGTTATGTACCAGCGCGATT
>probe:Drosophila_2:1629902_at:135:283; Interrogation_Position=3606; Antisense; CTGACCGACAATCCCTACAAGATGA
>probe:Drosophila_2:1629902_at:330:381; Interrogation_Position=3629; Antisense; GAACGGTCTGGATGCCATACCGGAT

Paste this into a BLAST search page for me
GATGTGACGCAATCTGCTGCCATAAGTAGACGCTACTGAAACTCCAAAGGATTGTGGGAATACGTCACCTGCGTCTAAGCCATTCAGATGCCGAGAGTTTGAGTTTATTAGGACCGCAGTCGCCCGGAATCCACTGAGTCTGAAGCGGTAAAATTTACGCCAGCCGCAAATGAGAATGAGACGTCGCCTCGAAATGGCAAGAAATGGCAATTGCCCGGTCGTCGAAAACAAGGCTTTCCGGCGCAACATGATGGACGAGCGTTTCAGCCGAGTTAAGCCGAGTTATGTACCAGCGCGATTCTGACCGACAATCCCTACAAGATGAGAACGGTCTGGATGCCATACCGGAT

Full Affymetrix probeset data:

Annotations for 1629902_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime