FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629903_at:

>probe:Drosophila_2:1629903_at:612:623; Interrogation_Position=1493; Antisense; TGCCCATCGCCGTGGATTACAAGGA
>probe:Drosophila_2:1629903_at:19:109; Interrogation_Position=1541; Antisense; AGAAGCCCCTTAGTCACCTGAACGT
>probe:Drosophila_2:1629903_at:310:383; Interrogation_Position=1560; Antisense; GAACGTCTTCAAACAGCTCTGGCAG
>probe:Drosophila_2:1629903_at:370:197; Interrogation_Position=1661; Antisense; AACGGTATCTCGAGCGTGATTCAAC
>probe:Drosophila_2:1629903_at:452:513; Interrogation_Position=1676; Antisense; GTGATTCAACGTACTTGACCCTTTT
>probe:Drosophila_2:1629903_at:521:597; Interrogation_Position=1691; Antisense; TGACCCTTTTGAACATTTACGACGG
>probe:Drosophila_2:1629903_at:414:161; Interrogation_Position=1728; Antisense; AAATTTGCTGCAGAGTTTCCCCGAC
>probe:Drosophila_2:1629903_at:495:595; Interrogation_Position=1773; Antisense; TGTGGTGGTCACAGAGCGATCTCAA
>probe:Drosophila_2:1629903_at:72:519; Interrogation_Position=1804; Antisense; GTGGGCGATCTCGTGAACTCAACAT
>probe:Drosophila_2:1629903_at:292:223; Interrogation_Position=1846; Antisense; AAGGATTCGCTTGTCCTGCAGACCA
>probe:Drosophila_2:1629903_at:284:131; Interrogation_Position=1870; Antisense; ACCTCCTCGTATTATAGCTATGCCA
>probe:Drosophila_2:1629903_at:96:423; Interrogation_Position=1901; Antisense; GAGAAACTCGTTTTCTTCCCGTGCT
>probe:Drosophila_2:1629903_at:54:531; Interrogation_Position=1928; Antisense; GGGTTTATCTATGGCTGGCTCAAGT
>probe:Drosophila_2:1629903_at:442:57; Interrogation_Position=1974; Antisense; ATGAGTTCCCACCATATGCTAGTTA

Paste this into a BLAST search page for me
TGCCCATCGCCGTGGATTACAAGGAAGAAGCCCCTTAGTCACCTGAACGTGAACGTCTTCAAACAGCTCTGGCAGAACGGTATCTCGAGCGTGATTCAACGTGATTCAACGTACTTGACCCTTTTTGACCCTTTTGAACATTTACGACGGAAATTTGCTGCAGAGTTTCCCCGACTGTGGTGGTCACAGAGCGATCTCAAGTGGGCGATCTCGTGAACTCAACATAAGGATTCGCTTGTCCTGCAGACCAACCTCCTCGTATTATAGCTATGCCAGAGAAACTCGTTTTCTTCCCGTGCTGGGTTTATCTATGGCTGGCTCAAGTATGAGTTCCCACCATATGCTAGTTA

Full Affymetrix probeset data:

Annotations for 1629903_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720