FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629904_at:

>probe:Drosophila_2:1629904_at:374:527; Interrogation_Position=1655; Antisense; GGGAAAATCCCAAAGCCCAGCGATA
>probe:Drosophila_2:1629904_at:608:27; Interrogation_Position=1677; Antisense; ATACCATCGGGCTCTGCGGGAGGAA
>probe:Drosophila_2:1629904_at:721:377; Interrogation_Position=1699; Antisense; GAAGCTCCCGGAAAAGTGGTCGATT
>probe:Drosophila_2:1629904_at:574:515; Interrogation_Position=1714; Antisense; GTGGTCGATTTAGGGCCAACTGGCT
>probe:Drosophila_2:1629904_at:505:333; Interrogation_Position=1736; Antisense; GCTGTATCAGTTCGAGTGGCTGCAA
>probe:Drosophila_2:1629904_at:279:615; Interrogation_Position=1756; Antisense; TGCAATACGACGAGCGGGCCAACAC
>probe:Drosophila_2:1629904_at:705:59; Interrogation_Position=1782; Antisense; ATGTTCTGCCGCCATTGTCGCAAAT
>probe:Drosophila_2:1629904_at:3:717; Interrogation_Position=1839; Antisense; TTCGTTGAGGGCAACTCCAACTTTC
>probe:Drosophila_2:1629904_at:694:147; Interrogation_Position=1858; Antisense; ACTTTCGCCTGGAGATCGTCAACCA
>probe:Drosophila_2:1629904_at:530:165; Interrogation_Position=1896; Antisense; AAATCGCATCGCATGTGCTACGAGC
>probe:Drosophila_2:1629904_at:614:43; Interrogation_Position=1945; Antisense; ATCCCATGCCCAGTGGAAGTGCAGG
>probe:Drosophila_2:1629904_at:265:77; Interrogation_Position=1967; Antisense; AGGAGGCAGCTCCAAGCGACGTTCC
>probe:Drosophila_2:1629904_at:416:187; Interrogation_Position=2058; Antisense; AACACACCGCTCAGGATTAGCCATA
>probe:Drosophila_2:1629904_at:192:491; Interrogation_Position=2140; Antisense; GTAACCTAAGAACTTGGCAGCTACT

Paste this into a BLAST search page for me
GGGAAAATCCCAAAGCCCAGCGATAATACCATCGGGCTCTGCGGGAGGAAGAAGCTCCCGGAAAAGTGGTCGATTGTGGTCGATTTAGGGCCAACTGGCTGCTGTATCAGTTCGAGTGGCTGCAATGCAATACGACGAGCGGGCCAACACATGTTCTGCCGCCATTGTCGCAAATTTCGTTGAGGGCAACTCCAACTTTCACTTTCGCCTGGAGATCGTCAACCAAAATCGCATCGCATGTGCTACGAGCATCCCATGCCCAGTGGAAGTGCAGGAGGAGGCAGCTCCAAGCGACGTTCCAACACACCGCTCAGGATTAGCCATAGTAACCTAAGAACTTGGCAGCTACT

Full Affymetrix probeset data:

Annotations for 1629904_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720