FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629907_at:

>probe:Drosophila_2:1629907_at:404:113; Interrogation_Position=1150; Antisense; AGCAGAATCACGCAGGGCTTCCAGT
>probe:Drosophila_2:1629907_at:534:273; Interrogation_Position=1167; Antisense; CTTCCAGTGCGTCGCCTCGGAGGAT
>probe:Drosophila_2:1629907_at:256:437; Interrogation_Position=1186; Antisense; GAGGATGAGGATGCCCTCCCAAAAG
>probe:Drosophila_2:1629907_at:260:253; Interrogation_Position=1236; Antisense; CAACCCGTATTTAGGTGATTGGTCA
>probe:Drosophila_2:1629907_at:35:231; Interrogation_Position=1321; Antisense; AATGTACACAACATATCGTGCGGTA
>probe:Drosophila_2:1629907_at:342:671; Interrogation_Position=1334; Antisense; TATCGTGCGGTAAACACTACCCAAA
>probe:Drosophila_2:1629907_at:706:29; Interrogation_Position=1402; Antisense; ATACACCTTGGTTCGATGGAATCAG
>probe:Drosophila_2:1629907_at:101:117; Interrogation_Position=1425; Antisense; AGCATATCAATTTACCACGAGGCAA
>probe:Drosophila_2:1629907_at:668:475; Interrogation_Position=1480; Antisense; GTTTTGGCTTACAAGTTATTGGCGA
>probe:Drosophila_2:1629907_at:382:239; Interrogation_Position=1528; Antisense; AATCAGCATCAATTAGGAGTGTCGC
>probe:Drosophila_2:1629907_at:181:77; Interrogation_Position=1542; Antisense; AGGAGTGTCGCAATTAGGCCAAAGT
>probe:Drosophila_2:1629907_at:140:67; Interrogation_Position=1557; Antisense; AGGCCAAAGTGCCAACCAAGAGTTT
>probe:Drosophila_2:1629907_at:219:1; Interrogation_Position=1594; Antisense; GGCCCTTAAACGCAAAAGCAACATT
>probe:Drosophila_2:1629907_at:538:647; Interrogation_Position=1712; Antisense; TCAGACGGGCTATACTGGATCTACC

Paste this into a BLAST search page for me
AGCAGAATCACGCAGGGCTTCCAGTCTTCCAGTGCGTCGCCTCGGAGGATGAGGATGAGGATGCCCTCCCAAAAGCAACCCGTATTTAGGTGATTGGTCAAATGTACACAACATATCGTGCGGTATATCGTGCGGTAAACACTACCCAAAATACACCTTGGTTCGATGGAATCAGAGCATATCAATTTACCACGAGGCAAGTTTTGGCTTACAAGTTATTGGCGAAATCAGCATCAATTAGGAGTGTCGCAGGAGTGTCGCAATTAGGCCAAAGTAGGCCAAAGTGCCAACCAAGAGTTTGGCCCTTAAACGCAAAAGCAACATTTCAGACGGGCTATACTGGATCTACC

Full Affymetrix probeset data:

Annotations for 1629907_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720