FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629910_at:

>probe:Drosophila_2:1629910_at:602:437; Interrogation_Position=141; Antisense; GATGACCTACCGCTGTGACTACAAG
>probe:Drosophila_2:1629910_at:676:549; Interrogation_Position=165; Antisense; GGAGTACTCCAACTGCAATACGTAT
>probe:Drosophila_2:1629910_at:309:687; Interrogation_Position=187; Antisense; TATATTCCAAGTCCCAACCATGATG
>probe:Drosophila_2:1629910_at:635:683; Interrogation_Position=232; Antisense; TATCCCGGAGATTGCAGGCGATTCT
>probe:Drosophila_2:1629910_at:529:157; Interrogation_Position=262; Antisense; ACACGTATCCTTCGCTGTGAGCAAA
>probe:Drosophila_2:1629910_at:337:483; Interrogation_Position=304; Antisense; GTATACCAGAGATGCGTTGTCCCAC
>probe:Drosophila_2:1629910_at:79:465; Interrogation_Position=319; Antisense; GTTGTCCCACAGTATGGCGATTGTC
>probe:Drosophila_2:1629910_at:9:361; Interrogation_Position=421; Antisense; GCAACCGTGATACCTTATGATCCCA
>probe:Drosophila_2:1629910_at:207:67; Interrogation_Position=481; Antisense; ATGGAATCTTTACCTCTGCCAATTG
>probe:Drosophila_2:1629910_at:608:727; Interrogation_Position=517; Antisense; TTGTGCAATAACAGTCCTCCCAATG
>probe:Drosophila_2:1629910_at:240:233; Interrogation_Position=538; Antisense; AATGCGTACATTCCTTATCCGGGCA
>probe:Drosophila_2:1629910_at:522:155; Interrogation_Position=592; Antisense; ACAGCAACCATTCTTTCATGCGCAG
>probe:Drosophila_2:1629910_at:690:49; Interrogation_Position=609; Antisense; ATGCGCAGGCTCCTCGAATTGGAAT
>probe:Drosophila_2:1629910_at:470:591; Interrogation_Position=666; Antisense; TGGGTGCCAGGCTTCTTTAAATTGA

Paste this into a BLAST search page for me
GATGACCTACCGCTGTGACTACAAGGGAGTACTCCAACTGCAATACGTATTATATTCCAAGTCCCAACCATGATGTATCCCGGAGATTGCAGGCGATTCTACACGTATCCTTCGCTGTGAGCAAAGTATACCAGAGATGCGTTGTCCCACGTTGTCCCACAGTATGGCGATTGTCGCAACCGTGATACCTTATGATCCCAATGGAATCTTTACCTCTGCCAATTGTTGTGCAATAACAGTCCTCCCAATGAATGCGTACATTCCTTATCCGGGCAACAGCAACCATTCTTTCATGCGCAGATGCGCAGGCTCCTCGAATTGGAATTGGGTGCCAGGCTTCTTTAAATTGA

Full Affymetrix probeset data:

Annotations for 1629910_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720