FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629911_at:

>probe:Drosophila_2:1629911_at:25:441; Interrogation_Position=1011; Antisense; GATGGTCGAGCACCTCAGATGTACG
>probe:Drosophila_2:1629911_at:442:99; Interrogation_Position=1027; Antisense; AGATGTACGCAATCCGCAGTCGGGT
>probe:Drosophila_2:1629911_at:134:691; Interrogation_Position=1106; Antisense; TTTGAGGAATCATACCGCTCGGCCA
>probe:Drosophila_2:1629911_at:547:671; Interrogation_Position=1118; Antisense; TACCGCTCGGCCAACAACATGATGA
>probe:Drosophila_2:1629911_at:380:533; Interrogation_Position=1171; Antisense; GGTGCAATCTAATCTAATACGCCGC
>probe:Drosophila_2:1629911_at:630:671; Interrogation_Position=1188; Antisense; TACGCCGCAATAGCTACATGGACAT
>probe:Drosophila_2:1629911_at:578:411; Interrogation_Position=1213; Antisense; GACCCGGTCCATATTCGAGTTGTAG
>probe:Drosophila_2:1629911_at:378:449; Interrogation_Position=1237; Antisense; GATCCGCCGATCAATGTCTTTATAT
>probe:Drosophila_2:1629911_at:444:451; Interrogation_Position=788; Antisense; GATCGGGAGCGATACTTCCACAAGT
>probe:Drosophila_2:1629911_at:62:179; Interrogation_Position=820; Antisense; AAAACGTGGACAGCCGAATGAGCCG
>probe:Drosophila_2:1629911_at:581:423; Interrogation_Position=848; Antisense; GAGAACATTCCAAGGCGTCCCATGC
>probe:Drosophila_2:1629911_at:718:291; Interrogation_Position=911; Antisense; CGTGCCTATGCTGGGATGTTGGATA
>probe:Drosophila_2:1629911_at:308:229; Interrogation_Position=952; Antisense; AATGGAGTTCAAGCGCGTGCATCCT
>probe:Drosophila_2:1629911_at:502:329; Interrogation_Position=966; Antisense; GCGTGCATCCTTGCGCCAAAATGGA

Paste this into a BLAST search page for me
GATGGTCGAGCACCTCAGATGTACGAGATGTACGCAATCCGCAGTCGGGTTTTGAGGAATCATACCGCTCGGCCATACCGCTCGGCCAACAACATGATGAGGTGCAATCTAATCTAATACGCCGCTACGCCGCAATAGCTACATGGACATGACCCGGTCCATATTCGAGTTGTAGGATCCGCCGATCAATGTCTTTATATGATCGGGAGCGATACTTCCACAAGTAAAACGTGGACAGCCGAATGAGCCGGAGAACATTCCAAGGCGTCCCATGCCGTGCCTATGCTGGGATGTTGGATAAATGGAGTTCAAGCGCGTGCATCCTGCGTGCATCCTTGCGCCAAAATGGA

Full Affymetrix probeset data:

Annotations for 1629911_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720