FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629916_at:

>probe:Drosophila_2:1629916_at:145:677; Interrogation_Position=1113; Antisense; TAGTTGCCAAGGATCTTTTTCGCTC
>probe:Drosophila_2:1629916_at:83:239; Interrogation_Position=1159; Antisense; AATCTCGATATTTGCCGTATGCGGC
>probe:Drosophila_2:1629916_at:412:329; Interrogation_Position=1200; Antisense; GCGTGCGCCAGGGACATTTCGACTA
>probe:Drosophila_2:1629916_at:94:19; Interrogation_Position=1215; Antisense; ATTTCGACTACCTACAGTGCCTGAT
>probe:Drosophila_2:1629916_at:276:669; Interrogation_Position=1277; Antisense; TACTGGCTGATCGACAACGGCGGAT
>probe:Drosophila_2:1629916_at:193:589; Interrogation_Position=1358; Antisense; TGGTTGACGCTGTTCGTGACTATCT
>probe:Drosophila_2:1629916_at:648:511; Interrogation_Position=1373; Antisense; GTGACTATCTCTGCAGGCGCATATA
>probe:Drosophila_2:1629916_at:354:65; Interrogation_Position=1397; Antisense; ATGGTCTCAAACGTGTGTCGGCGCA
>probe:Drosophila_2:1629916_at:485:549; Interrogation_Position=1424; Antisense; GGAGGTCAACTGTATTCGCTGCTGT
>probe:Drosophila_2:1629916_at:672:283; Interrogation_Position=1442; Antisense; CTGCTGTTCTAGATTCGCTTGGGAT
>probe:Drosophila_2:1629916_at:218:711; Interrogation_Position=1511; Antisense; TTCAAATCATTCCTGCTTCCATGGG
>probe:Drosophila_2:1629916_at:481:267; Interrogation_Position=1530; Antisense; CATGGGCACCAGTCGTTTAGTAGTA
>probe:Drosophila_2:1629916_at:246:655; Interrogation_Position=1578; Antisense; TAATATTGTTATTCCCTTTCTCCTC
>probe:Drosophila_2:1629916_at:52:307; Interrogation_Position=1592; Antisense; CCTTTCTCCTCTTTTTGTACATACA

Paste this into a BLAST search page for me
TAGTTGCCAAGGATCTTTTTCGCTCAATCTCGATATTTGCCGTATGCGGCGCGTGCGCCAGGGACATTTCGACTAATTTCGACTACCTACAGTGCCTGATTACTGGCTGATCGACAACGGCGGATTGGTTGACGCTGTTCGTGACTATCTGTGACTATCTCTGCAGGCGCATATAATGGTCTCAAACGTGTGTCGGCGCAGGAGGTCAACTGTATTCGCTGCTGTCTGCTGTTCTAGATTCGCTTGGGATTTCAAATCATTCCTGCTTCCATGGGCATGGGCACCAGTCGTTTAGTAGTATAATATTGTTATTCCCTTTCTCCTCCCTTTCTCCTCTTTTTGTACATACA

Full Affymetrix probeset data:

Annotations for 1629916_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720