Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629918_at:

>probe:Drosophila_2:1629918_at:689:547; Interrogation_Position=2210; Antisense; GGAGTTCGAAGTGCGTCACGGCAAC
>probe:Drosophila_2:1629918_at:228:395; Interrogation_Position=2250; Antisense; GAAATGCTGCGCATCAAGCGCTCTG
>probe:Drosophila_2:1629918_at:99:597; Interrogation_Position=2273; Antisense; TGTGCAGGCCACTTACAATACGCAG
>probe:Drosophila_2:1629918_at:159:29; Interrogation_Position=2290; Antisense; ATACGCAGGTGAACATGATGGCCGC
>probe:Drosophila_2:1629918_at:211:413; Interrogation_Position=2368; Antisense; GACCGGATGCCATGCGATTGCTGGA
>probe:Drosophila_2:1629918_at:614:431; Interrogation_Position=2418; Antisense; GAGTCCAAACAGAAGCCCATCGAGA
>probe:Drosophila_2:1629918_at:329:371; Interrogation_Position=2441; Antisense; GAAGGCGGCCTCGAATATTATGTTT
>probe:Drosophila_2:1629918_at:417:687; Interrogation_Position=2456; Antisense; TATTATGTTTGTGCGCGGTGAGACT
>probe:Drosophila_2:1629918_at:330:457; Interrogation_Position=2505; Antisense; GATACGGTCGTCAATCCTGATGAGA
>probe:Drosophila_2:1629918_at:156:423; Interrogation_Position=2598; Antisense; GAGAATCAGGCCAGTGCAGCGGTCA
>probe:Drosophila_2:1629918_at:317:371; Interrogation_Position=2637; Antisense; GAAGGCCTGGTCATGAAGAAACTGC
>probe:Drosophila_2:1629918_at:545:193; Interrogation_Position=2656; Antisense; AACTGCGCTTCGAACAAAAGGCCAT
>probe:Drosophila_2:1629918_at:211:185; Interrogation_Position=2671; Antisense; AAAAGGCCATTCCAGCCAAGGTCTT
>probe:Drosophila_2:1629918_at:377:123; Interrogation_Position=2707; Antisense; AGCCCTCAAATCAAGGCGACTCTGA

Paste this into a BLAST search page for me
GGAGTTCGAAGTGCGTCACGGCAACGAAATGCTGCGCATCAAGCGCTCTGTGTGCAGGCCACTTACAATACGCAGATACGCAGGTGAACATGATGGCCGCGACCGGATGCCATGCGATTGCTGGAGAGTCCAAACAGAAGCCCATCGAGAGAAGGCGGCCTCGAATATTATGTTTTATTATGTTTGTGCGCGGTGAGACTGATACGGTCGTCAATCCTGATGAGAGAGAATCAGGCCAGTGCAGCGGTCAGAAGGCCTGGTCATGAAGAAACTGCAACTGCGCTTCGAACAAAAGGCCATAAAAGGCCATTCCAGCCAAGGTCTTAGCCCTCAAATCAAGGCGACTCTGA

Full Affymetrix probeset data:

Annotations for 1629918_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime