Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629920_at:

>probe:Drosophila_2:1629920_at:397:257; Interrogation_Position=1720; Antisense; CAGCACCGGATTTAACTTTTAGCAC
>probe:Drosophila_2:1629920_at:702:129; Interrogation_Position=1748; Antisense; ACCGCGCAGGACATCGTTTAACTAT
>probe:Drosophila_2:1629920_at:610:25; Interrogation_Position=1777; Antisense; ATACGAATCCCTCAAGTCCTAAACA
>probe:Drosophila_2:1629920_at:209:305; Interrogation_Position=1831; Antisense; CCTTGCCGCCGGGATTTAAATGAAG
>probe:Drosophila_2:1629920_at:227:55; Interrogation_Position=1850; Antisense; ATGAAGGCGGCCAGAGCACGGACAT
>probe:Drosophila_2:1629920_at:46:413; Interrogation_Position=1883; Antisense; GACCGCATGAGAAGGCGTCTGCCTT
>probe:Drosophila_2:1629920_at:538:717; Interrogation_Position=1906; Antisense; TTGCCCAAGTGCAGTCACTACTAGC
>probe:Drosophila_2:1629920_at:454:169; Interrogation_Position=1939; Antisense; AAAGATGGTCGTTCGGTCGGCTCGT
>probe:Drosophila_2:1629920_at:246:639; Interrogation_Position=1951; Antisense; TCGGTCGGCTCGTTTCTTTGTTACA
>probe:Drosophila_2:1629920_at:591:239; Interrogation_Position=1975; Antisense; AATCACTCACCTGCTTATTGTATCA
>probe:Drosophila_2:1629920_at:623:535; Interrogation_Position=2026; Antisense; GGTCCAGGACCAGGCATGACGAGAT
>probe:Drosophila_2:1629920_at:66:17; Interrogation_Position=2161; Antisense; ATTTTCCAGCCCAAGTACGATGAGA
>probe:Drosophila_2:1629920_at:229:445; Interrogation_Position=2179; Antisense; GATGAGATCCTCACATGGTGTTGTT
>probe:Drosophila_2:1629920_at:467:453; Interrogation_Position=2222; Antisense; GATCATTTTGTTATGCGAATCGCCG

Paste this into a BLAST search page for me
CAGCACCGGATTTAACTTTTAGCACACCGCGCAGGACATCGTTTAACTATATACGAATCCCTCAAGTCCTAAACACCTTGCCGCCGGGATTTAAATGAAGATGAAGGCGGCCAGAGCACGGACATGACCGCATGAGAAGGCGTCTGCCTTTTGCCCAAGTGCAGTCACTACTAGCAAAGATGGTCGTTCGGTCGGCTCGTTCGGTCGGCTCGTTTCTTTGTTACAAATCACTCACCTGCTTATTGTATCAGGTCCAGGACCAGGCATGACGAGATATTTTCCAGCCCAAGTACGATGAGAGATGAGATCCTCACATGGTGTTGTTGATCATTTTGTTATGCGAATCGCCG

Full Affymetrix probeset data:

Annotations for 1629920_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime