FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629922_at:

>probe:Drosophila_2:1629922_at:428:431; Interrogation_Position=3543; Antisense; GAGTCTGGGCTTAGACGACATCGAT
>probe:Drosophila_2:1629922_at:481:285; Interrogation_Position=3640; Antisense; CGGAATGGATCTCTCGACGACTTGG
>probe:Drosophila_2:1629922_at:95:407; Interrogation_Position=3655; Antisense; GACGACTTGGCAGACTCATTTGGAC
>probe:Drosophila_2:1629922_at:555:19; Interrogation_Position=3672; Antisense; ATTTGGACCTGATCCTGTCAGCGAG
>probe:Drosophila_2:1629922_at:155:371; Interrogation_Position=3720; Antisense; GAATGGATTTTACTTCCTGGCCGAC
>probe:Drosophila_2:1629922_at:605:539; Interrogation_Position=3746; Antisense; GGAACTCGTTCCTCGAAGTGGGTGA
>probe:Drosophila_2:1629922_at:397:81; Interrogation_Position=3782; Antisense; AGGTGGTGGTTCGACTCAGTCCCAA
>probe:Drosophila_2:1629922_at:633:623; Interrogation_Position=3830; Antisense; TGCCCGTTAAGATTCCCTCGTAGGA
>probe:Drosophila_2:1629922_at:650:75; Interrogation_Position=3854; Antisense; AGGATCCTTCGGACAGGCTAACTGT
>probe:Drosophila_2:1629922_at:598:335; Interrogation_Position=3870; Antisense; GCTAACTGTACATATGTTTCCTCCC
>probe:Drosophila_2:1629922_at:307:505; Interrogation_Position=3904; Antisense; GTCCTCTTCCAAGCGTTATCGTAAT
>probe:Drosophila_2:1629922_at:661:727; Interrogation_Position=3942; Antisense; TTGTAGTCACTGTCCTCTCAATCTG
>probe:Drosophila_2:1629922_at:142:251; Interrogation_Position=3991; Antisense; CAATCCGTGGGCTCATAGTCGTAAG
>probe:Drosophila_2:1629922_at:208:271; Interrogation_Position=4004; Antisense; CATAGTCGTAAGTCCGGCCTAGGAT

Paste this into a BLAST search page for me
GAGTCTGGGCTTAGACGACATCGATCGGAATGGATCTCTCGACGACTTGGGACGACTTGGCAGACTCATTTGGACATTTGGACCTGATCCTGTCAGCGAGGAATGGATTTTACTTCCTGGCCGACGGAACTCGTTCCTCGAAGTGGGTGAAGGTGGTGGTTCGACTCAGTCCCAATGCCCGTTAAGATTCCCTCGTAGGAAGGATCCTTCGGACAGGCTAACTGTGCTAACTGTACATATGTTTCCTCCCGTCCTCTTCCAAGCGTTATCGTAATTTGTAGTCACTGTCCTCTCAATCTGCAATCCGTGGGCTCATAGTCGTAAGCATAGTCGTAAGTCCGGCCTAGGAT

Full Affymetrix probeset data:

Annotations for 1629922_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720