Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629923_at:

>probe:Drosophila_2:1629923_at:377:439; Interrogation_Position=1667; Antisense; GAGGCATTCAGAGAGCAGCTCAACT
>probe:Drosophila_2:1629923_at:271:581; Interrogation_Position=1722; Antisense; TGGCCCCTCATTTCGGAGGCATTAT
>probe:Drosophila_2:1629923_at:476:547; Interrogation_Position=1736; Antisense; GGAGGCATTATTCAGTTCGTCAAGG
>probe:Drosophila_2:1629923_at:431:433; Interrogation_Position=1760; Antisense; GAGTGCGAGCACTTCTTCGAGAAGG
>probe:Drosophila_2:1629923_at:306:211; Interrogation_Position=1816; Antisense; AAGAAGTCTGGCCTTGGTCGCCAGC
>probe:Drosophila_2:1629923_at:698:263; Interrogation_Position=1837; Antisense; CAGCTTCTCGGCCAATTGGAAGAAA
>probe:Drosophila_2:1629923_at:170:189; Interrogation_Position=1877; Antisense; AACAGGGAGGTGCTTCTCTCATTTC
>probe:Drosophila_2:1629923_at:691:17; Interrogation_Position=1897; Antisense; ATTTCCCTCATTGCTGACGGGCTCA
>probe:Drosophila_2:1629923_at:342:117; Interrogation_Position=1923; Antisense; AGCTTCTGCAGCTTGCGTTGGCCAG
>probe:Drosophila_2:1629923_at:659:327; Interrogation_Position=1937; Antisense; GCGTTGGCCAGTTTGGTGCAATACT
>probe:Drosophila_2:1629923_at:159:511; Interrogation_Position=1952; Antisense; GTGCAATACTATCACCGATTCCACA
>probe:Drosophila_2:1629923_at:305:119; Interrogation_Position=2004; Antisense; AGCTGACCAATATCCACGTCGTGAT
>probe:Drosophila_2:1629923_at:112:421; Interrogation_Position=2050; Antisense; GAGCAATTACTGAGGGACGCTTTAA
>probe:Drosophila_2:1629923_at:312:517; Interrogation_Position=2087; Antisense; GTGTGTCTTCTGTGTATTCCAAATT

Paste this into a BLAST search page for me
GAGGCATTCAGAGAGCAGCTCAACTTGGCCCCTCATTTCGGAGGCATTATGGAGGCATTATTCAGTTCGTCAAGGGAGTGCGAGCACTTCTTCGAGAAGGAAGAAGTCTGGCCTTGGTCGCCAGCCAGCTTCTCGGCCAATTGGAAGAAAAACAGGGAGGTGCTTCTCTCATTTCATTTCCCTCATTGCTGACGGGCTCAAGCTTCTGCAGCTTGCGTTGGCCAGGCGTTGGCCAGTTTGGTGCAATACTGTGCAATACTATCACCGATTCCACAAGCTGACCAATATCCACGTCGTGATGAGCAATTACTGAGGGACGCTTTAAGTGTGTCTTCTGTGTATTCCAAATT

Full Affymetrix probeset data:

Annotations for 1629923_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime