FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629924_at:

>probe:Drosophila_2:1629924_at:122:201; Interrogation_Position=1022; Antisense; AACCGATGCGGACCTCAGCAAATGG
>probe:Drosophila_2:1629924_at:726:559; Interrogation_Position=1045; Antisense; GGAAATGCGACCCAACTACGAACTC
>probe:Drosophila_2:1629924_at:378:193; Interrogation_Position=1080; Antisense; AACTAATGGGATCGCGTGACGGTCA
>probe:Drosophila_2:1629924_at:563:509; Interrogation_Position=1095; Antisense; GTGACGGTCAAACGGATCCAACCAA
>probe:Drosophila_2:1629924_at:333:607; Interrogation_Position=1125; Antisense; TGAGGAAATCGCTACCCAATTCACG
>probe:Drosophila_2:1629924_at:334:669; Interrogation_Position=1137; Antisense; TACCCAATTCACGACTACAGGCAAT
>probe:Drosophila_2:1629924_at:464:565; Interrogation_Position=1156; Antisense; GGCAATTGAATCGTACATGGGTCTA
>probe:Drosophila_2:1629924_at:679:61; Interrogation_Position=1172; Antisense; ATGGGTCTAACCACCGACAACGAGG
>probe:Drosophila_2:1629924_at:185:677; Interrogation_Position=1231; Antisense; TAGACTGCTGCAACTGGAGTCCATT
>probe:Drosophila_2:1629924_at:108:589; Interrogation_Position=1245; Antisense; TGGAGTCCATTTCGCCCGAGTACAG
>probe:Drosophila_2:1629924_at:58:431; Interrogation_Position=1262; Antisense; GAGTACAGACACTTCACCAAACGTG
>probe:Drosophila_2:1629924_at:496:379; Interrogation_Position=1286; Antisense; GAACCGTCATCTATGGAAGCCGCGC
>probe:Drosophila_2:1629924_at:687:41; Interrogation_Position=910; Antisense; ATCGTCTTTTGTCAGCTCAGACCAA
>probe:Drosophila_2:1629924_at:566:397; Interrogation_Position=929; Antisense; GACCAAAACTTGAGCGATTCCTGCG

Paste this into a BLAST search page for me
AACCGATGCGGACCTCAGCAAATGGGGAAATGCGACCCAACTACGAACTCAACTAATGGGATCGCGTGACGGTCAGTGACGGTCAAACGGATCCAACCAATGAGGAAATCGCTACCCAATTCACGTACCCAATTCACGACTACAGGCAATGGCAATTGAATCGTACATGGGTCTAATGGGTCTAACCACCGACAACGAGGTAGACTGCTGCAACTGGAGTCCATTTGGAGTCCATTTCGCCCGAGTACAGGAGTACAGACACTTCACCAAACGTGGAACCGTCATCTATGGAAGCCGCGCATCGTCTTTTGTCAGCTCAGACCAAGACCAAAACTTGAGCGATTCCTGCG

Full Affymetrix probeset data:

Annotations for 1629924_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720