Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629926_at:

>probe:Drosophila_2:1629926_at:383:85; Interrogation_Position=1475; Antisense; AGTGATGTGATTTCCCAGCTGCAGA
>probe:Drosophila_2:1629926_at:181:105; Interrogation_Position=1497; Antisense; AGACGAGTGACTTCCTGTTGGCCAA
>probe:Drosophila_2:1629926_at:565:553; Interrogation_Position=1540; Antisense; GGAGCTGCATATTTCGATGCCCAAA
>probe:Drosophila_2:1629926_at:618:335; Interrogation_Position=1587; Antisense; GCTCCGAGGCAATGCTCAAGCAGAT
>probe:Drosophila_2:1629926_at:508:221; Interrogation_Position=1622; Antisense; AAGGTCTTCTCGAGGACCGAAGCTC
>probe:Drosophila_2:1629926_at:79:119; Interrogation_Position=1642; Antisense; AGCTCAGTTGAGCTTGCTGTCCGAG
>probe:Drosophila_2:1629926_at:30:79; Interrogation_Position=1665; Antisense; AGGATCCCGATGTCCACGTGGATGA
>probe:Drosophila_2:1629926_at:357:87; Interrogation_Position=1693; Antisense; AGTCCAGTTCGTAAATGTTCGCGTG
>probe:Drosophila_2:1629926_at:183:381; Interrogation_Position=1835; Antisense; GAACGCTTCGAGGTGAATCGTCCTT
>probe:Drosophila_2:1629926_at:519:615; Interrogation_Position=1848; Antisense; TGAATCGTCCTTTTGCCTACTTCAT
>probe:Drosophila_2:1629926_at:533:667; Interrogation_Position=1865; Antisense; TACTTCATCGTCGACTGCCAGGAGC
>probe:Drosophila_2:1629926_at:83:711; Interrogation_Position=1929; Antisense; TTAAGGAAGATCTGCCCTCAGTCTC
>probe:Drosophila_2:1629926_at:609:263; Interrogation_Position=1973; Antisense; CAGTCTTAGTCTGCTAGCTTAGTAA
>probe:Drosophila_2:1629926_at:391:199; Interrogation_Position=1996; Antisense; AACGAATTTTCACCGATCCATGCAA

Paste this into a BLAST search page for me
AGTGATGTGATTTCCCAGCTGCAGAAGACGAGTGACTTCCTGTTGGCCAAGGAGCTGCATATTTCGATGCCCAAAGCTCCGAGGCAATGCTCAAGCAGATAAGGTCTTCTCGAGGACCGAAGCTCAGCTCAGTTGAGCTTGCTGTCCGAGAGGATCCCGATGTCCACGTGGATGAAGTCCAGTTCGTAAATGTTCGCGTGGAACGCTTCGAGGTGAATCGTCCTTTGAATCGTCCTTTTGCCTACTTCATTACTTCATCGTCGACTGCCAGGAGCTTAAGGAAGATCTGCCCTCAGTCTCCAGTCTTAGTCTGCTAGCTTAGTAAAACGAATTTTCACCGATCCATGCAA

Full Affymetrix probeset data:

Annotations for 1629926_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime