Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629927_at:

>probe:Drosophila_2:1629927_at:730:489; Interrogation_Position=1770; Antisense; GTACAAGAGTCTTCGCCGACGGCAA
>probe:Drosophila_2:1629927_at:356:483; Interrogation_Position=1818; Antisense; GTATATCTACGTGTTCAACTGGACA
>probe:Drosophila_2:1629927_at:212:611; Interrogation_Position=1848; Antisense; TGAACTAGACTAGCGGACCGACCGA
>probe:Drosophila_2:1629927_at:390:117; Interrogation_Position=1891; Antisense; AGCTTCACATCAGCTTGACCTTGTG
>probe:Drosophila_2:1629927_at:657:593; Interrogation_Position=1912; Antisense; TGTGGTCCAACTGATCGGCGTCGAT
>probe:Drosophila_2:1629927_at:489:327; Interrogation_Position=1929; Antisense; GCGTCGATCTTCTTGGCGAACAGCA
>probe:Drosophila_2:1629927_at:177:111; Interrogation_Position=1993; Antisense; AGAATCGCTCGTGCATCTTGTTGGC
>probe:Drosophila_2:1629927_at:99:725; Interrogation_Position=2010; Antisense; TTGTTGGCCGTGTGCTGGAACTCGC
>probe:Drosophila_2:1629927_at:146:125; Interrogation_Position=2049; Antisense; AGCGCCTTGGTGAAGTACTCCGTGA
>probe:Drosophila_2:1629927_at:403:209; Interrogation_Position=2073; Antisense; AAGAGGCGGCCCATGTACTGGTCTT
>probe:Drosophila_2:1629927_at:728:487; Interrogation_Position=2087; Antisense; GTACTGGTCTTTGGTGGACGGCCAC
>probe:Drosophila_2:1629927_at:341:35; Interrogation_Position=2151; Antisense; ATCACGATGGCCACATGGGTGCACT
>probe:Drosophila_2:1629927_at:516:585; Interrogation_Position=2211; Antisense; TGGAACGGATCATCGGCGGCGCTCA
>probe:Drosophila_2:1629927_at:630:465; Interrogation_Position=2270; Antisense; GTTGTGCAACGTGGCATCCGAGTAA

Paste this into a BLAST search page for me
GTACAAGAGTCTTCGCCGACGGCAAGTATATCTACGTGTTCAACTGGACATGAACTAGACTAGCGGACCGACCGAAGCTTCACATCAGCTTGACCTTGTGTGTGGTCCAACTGATCGGCGTCGATGCGTCGATCTTCTTGGCGAACAGCAAGAATCGCTCGTGCATCTTGTTGGCTTGTTGGCCGTGTGCTGGAACTCGCAGCGCCTTGGTGAAGTACTCCGTGAAAGAGGCGGCCCATGTACTGGTCTTGTACTGGTCTTTGGTGGACGGCCACATCACGATGGCCACATGGGTGCACTTGGAACGGATCATCGGCGGCGCTCAGTTGTGCAACGTGGCATCCGAGTAA

Full Affymetrix probeset data:

Annotations for 1629927_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime