Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629928_a_at:

>probe:Drosophila_2:1629928_a_at:141:521; Interrogation_Position=360; Antisense; GTGGAACTATCGTCAGAAAGTTGAT
>probe:Drosophila_2:1629928_a_at:314:393; Interrogation_Position=375; Antisense; GAAAGTTGATTTGGAAACATCGGTA
>probe:Drosophila_2:1629928_a_at:729:389; Interrogation_Position=388; Antisense; GAAACATCGGTAAAGATATCGCCGT
>probe:Drosophila_2:1629928_a_at:40:459; Interrogation_Position=402; Antisense; GATATCGCCGTATTGCAATTCTTGG
>probe:Drosophila_2:1629928_a_at:697:5; Interrogation_Position=413; Antisense; ATTGCAATTCTTGGCCATCGGCTTG
>probe:Drosophila_2:1629928_a_at:355:271; Interrogation_Position=428; Antisense; CATCGGCTTGTTGGTTTACTCTTAA
>probe:Drosophila_2:1629928_a_at:500:369; Interrogation_Position=437; Antisense; GTTGGTTTACTCTTAAAGGCATTGA
>probe:Drosophila_2:1629928_a_at:197:227; Interrogation_Position=452; Antisense; AAGGCATTGATTTGTTGAAACTTCT
>probe:Drosophila_2:1629928_a_at:567:611; Interrogation_Position=467; Antisense; TGAAACTTCTGGTATTGGAAAGATC
>probe:Drosophila_2:1629928_a_at:358:585; Interrogation_Position=482; Antisense; TGGAAAGATCACCAACTTACCTGGT
>probe:Drosophila_2:1629928_a_at:107:191; Interrogation_Position=495; Antisense; AACTTACCTGGTGATTCTTACGATT
>probe:Drosophila_2:1629928_a_at:623:285; Interrogation_Position=502; Antisense; CTGGTGATTCTTACGATTGTCCTTA
>probe:Drosophila_2:1629928_a_at:537:465; Interrogation_Position=516; Antisense; GATTGTCCTTATCGTACTCCTCTTA
>probe:Drosophila_2:1629928_a_at:80:625; Interrogation_Position=637; Antisense; TGCCTATGTCGGAGATTGAGTCACT

Paste this into a BLAST search page for me
GTGGAACTATCGTCAGAAAGTTGATGAAAGTTGATTTGGAAACATCGGTAGAAACATCGGTAAAGATATCGCCGTGATATCGCCGTATTGCAATTCTTGGATTGCAATTCTTGGCCATCGGCTTGCATCGGCTTGTTGGTTTACTCTTAAGTTGGTTTACTCTTAAAGGCATTGAAAGGCATTGATTTGTTGAAACTTCTTGAAACTTCTGGTATTGGAAAGATCTGGAAAGATCACCAACTTACCTGGTAACTTACCTGGTGATTCTTACGATTCTGGTGATTCTTACGATTGTCCTTAGATTGTCCTTATCGTACTCCTCTTATGCCTATGTCGGAGATTGAGTCACT

Full Affymetrix probeset data:

Annotations for 1629928_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime