FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629932_at:

>probe:Drosophila_2:1629932_at:369:415; Interrogation_Position=1017; Antisense; GAGCGAGTCCGGCTTTCTGATCTGC
>probe:Drosophila_2:1629932_at:598:125; Interrogation_Position=1060; Antisense; AGCCTTTTGGCCTGGAACATTCGCA
>probe:Drosophila_2:1629932_at:332:445; Interrogation_Position=1123; Antisense; GATGAGCAGCGACTGCAGTTCGCCA
>probe:Drosophila_2:1629932_at:600:195; Interrogation_Position=1187; Antisense; AACTGTGGGTGCTGTCGAATCGGCT
>probe:Drosophila_2:1629932_at:614:173; Interrogation_Position=1216; Antisense; AAAGCCTTCGGAGCGGGTCTGGACT
>probe:Drosophila_2:1629932_at:22:569; Interrogation_Position=1294; Antisense; GGCAGGCCTTGCAACTGAGTCGCTT
>probe:Drosophila_2:1629932_at:21:719; Interrogation_Position=1317; Antisense; TTCCCGCTGCTGCTCAATAAAGCTA
>probe:Drosophila_2:1629932_at:420:403; Interrogation_Position=763; Antisense; GACTTCGGCACATTCACGATAGCAG
>probe:Drosophila_2:1629932_at:254:101; Interrogation_Position=791; Antisense; AGAGCTTCCAGCTGTGGGACGGCAC
>probe:Drosophila_2:1629932_at:644:547; Interrogation_Position=857; Antisense; GGATGATGTATTTCCACTCTCTGTC
>probe:Drosophila_2:1629932_at:690:145; Interrogation_Position=872; Antisense; ACTCTCTGTCCAGCGAGTGGCAAAT
>probe:Drosophila_2:1629932_at:621:67; Interrogation_Position=895; Antisense; ATGGCCATTCCGTTGGATGTGGTCA
>probe:Drosophila_2:1629932_at:40:139; Interrogation_Position=944; Antisense; ACGATGTGAGCGCTGCCTTGGATCA
>probe:Drosophila_2:1629932_at:707:373; Interrogation_Position=992; Antisense; GAAGTCAATGCGTTGCGGCGGCCAT

Paste this into a BLAST search page for me
GAGCGAGTCCGGCTTTCTGATCTGCAGCCTTTTGGCCTGGAACATTCGCAGATGAGCAGCGACTGCAGTTCGCCAAACTGTGGGTGCTGTCGAATCGGCTAAAGCCTTCGGAGCGGGTCTGGACTGGCAGGCCTTGCAACTGAGTCGCTTTTCCCGCTGCTGCTCAATAAAGCTAGACTTCGGCACATTCACGATAGCAGAGAGCTTCCAGCTGTGGGACGGCACGGATGATGTATTTCCACTCTCTGTCACTCTCTGTCCAGCGAGTGGCAAATATGGCCATTCCGTTGGATGTGGTCAACGATGTGAGCGCTGCCTTGGATCAGAAGTCAATGCGTTGCGGCGGCCAT

Full Affymetrix probeset data:

Annotations for 1629932_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720