FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629933_at:

>probe:Drosophila_2:1629933_at:27:333; Interrogation_Position=1157; Antisense; GCGGCATCACCTATCAGATGGCCAA
>probe:Drosophila_2:1629933_at:444:225; Interrogation_Position=1210; Antisense; AAGGAGCTGCGCAATCCGCGCGTTA
>probe:Drosophila_2:1629933_at:422:357; Interrogation_Position=1244; Antisense; GCAAATACCGAAAGGCGCTCATCCG
>probe:Drosophila_2:1629933_at:725:141; Interrogation_Position=1313; Antisense; ACGGCGGCGAATTGTCCGGCATCAA
>probe:Drosophila_2:1629933_at:677:649; Interrogation_Position=1334; Antisense; TCAAGGCCGGCGTCACGAAGAGCGT
>probe:Drosophila_2:1629933_at:546:375; Interrogation_Position=1350; Antisense; GAAGAGCGTCAAGTTCCGCACCTAG
>probe:Drosophila_2:1629933_at:157:471; Interrogation_Position=1362; Antisense; GTTCCGCACCTAGTTTTTATCCAAT
>probe:Drosophila_2:1629933_at:38:45; Interrogation_Position=1389; Antisense; ATCCGCCAAGATCATTACATTTTAA
>probe:Drosophila_2:1629933_at:151:293; Interrogation_Position=1443; Antisense; CCATTTCATCCAAAGACTCACCGGG
>probe:Drosophila_2:1629933_at:460:89; Interrogation_Position=1472; Antisense; AGTCAACTAGCTGTCATATGCGAAA
>probe:Drosophila_2:1629933_at:62:151; Interrogation_Position=1504; Antisense; ACATTTTTCTTCACTTGGTTCATCA
>probe:Drosophila_2:1629933_at:630:477; Interrogation_Position=1576; Antisense; GTTTTTCTCTTTGTACAGTGTTCTC
>probe:Drosophila_2:1629933_at:246:85; Interrogation_Position=1592; Antisense; AGTGTTCTCCAACCTTGTCTGTTTA
>probe:Drosophila_2:1629933_at:425:497; Interrogation_Position=1608; Antisense; GTCTGTTTAGGTTGCCTTAAATCTA

Paste this into a BLAST search page for me
GCGGCATCACCTATCAGATGGCCAAAAGGAGCTGCGCAATCCGCGCGTTAGCAAATACCGAAAGGCGCTCATCCGACGGCGGCGAATTGTCCGGCATCAATCAAGGCCGGCGTCACGAAGAGCGTGAAGAGCGTCAAGTTCCGCACCTAGGTTCCGCACCTAGTTTTTATCCAATATCCGCCAAGATCATTACATTTTAACCATTTCATCCAAAGACTCACCGGGAGTCAACTAGCTGTCATATGCGAAAACATTTTTCTTCACTTGGTTCATCAGTTTTTCTCTTTGTACAGTGTTCTCAGTGTTCTCCAACCTTGTCTGTTTAGTCTGTTTAGGTTGCCTTAAATCTA

Full Affymetrix probeset data:

Annotations for 1629933_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720