FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629934_at:

>probe:Drosophila_2:1629934_at:467:463; Interrogation_Position=1620; Antisense; GATTGCGTTGTCACTGATAGCCAGC
>probe:Drosophila_2:1629934_at:307:117; Interrogation_Position=1642; Antisense; AGCTGCCTGTTTTCGATCTATGGTC
>probe:Drosophila_2:1629934_at:259:495; Interrogation_Position=1664; Antisense; GTCAGAACACGTTGCCCATTGTGGA
>probe:Drosophila_2:1629934_at:286:669; Interrogation_Position=1699; Antisense; TACGTAAGCCTAACCAGGATCGCCT
>probe:Drosophila_2:1629934_at:175:365; Interrogation_Position=1877; Antisense; GAATCACGCACACAAGTACCTACTT
>probe:Drosophila_2:1629934_at:430:441; Interrogation_Position=1917; Antisense; GATGCTTCGATTCTGGACGGACTTT
>probe:Drosophila_2:1629934_at:105:407; Interrogation_Position=1932; Antisense; GACGGACTTTGGCTTTACGATTCTG
>probe:Drosophila_2:1629934_at:649:9; Interrogation_Position=1951; Antisense; ATTCTGTTCTCGTACCTCATGCATA
>probe:Drosophila_2:1629934_at:647:343; Interrogation_Position=1971; Antisense; GCATATCCTAATCGAAGCGCCATTC
>probe:Drosophila_2:1629934_at:564:9; Interrogation_Position=1992; Antisense; ATTCGCCGGTCTGGAAAGCCTTTTG
>probe:Drosophila_2:1629934_at:639:71; Interrogation_Position=2081; Antisense; AGGCATCAGTCGAAGAATCTCCAGT
>probe:Drosophila_2:1629934_at:173:205; Interrogation_Position=2110; Antisense; AAGCCTGCGGAAGCGATATCCACGA
>probe:Drosophila_2:1629934_at:310:457; Interrogation_Position=2124; Antisense; GATATCCACGATACCCGACGAAGTT
>probe:Drosophila_2:1629934_at:681:215; Interrogation_Position=2144; Antisense; AAGTTATTCAGGCTGCTCCCGAAAA

Paste this into a BLAST search page for me
GATTGCGTTGTCACTGATAGCCAGCAGCTGCCTGTTTTCGATCTATGGTCGTCAGAACACGTTGCCCATTGTGGATACGTAAGCCTAACCAGGATCGCCTGAATCACGCACACAAGTACCTACTTGATGCTTCGATTCTGGACGGACTTTGACGGACTTTGGCTTTACGATTCTGATTCTGTTCTCGTACCTCATGCATAGCATATCCTAATCGAAGCGCCATTCATTCGCCGGTCTGGAAAGCCTTTTGAGGCATCAGTCGAAGAATCTCCAGTAAGCCTGCGGAAGCGATATCCACGAGATATCCACGATACCCGACGAAGTTAAGTTATTCAGGCTGCTCCCGAAAA

Full Affymetrix probeset data:

Annotations for 1629934_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720