FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629935_at:

>probe:Drosophila_2:1629935_at:36:155; Interrogation_Position=1000; Antisense; ACAGTGGCCAGTTTAACCCTCAATG
>probe:Drosophila_2:1629935_at:598:447; Interrogation_Position=456; Antisense; GATGCCGACCTGTTCGTATAGCGAT
>probe:Drosophila_2:1629935_at:646:47; Interrogation_Position=552; Antisense; ATCCACTTACTGTGCGGCGGTTCAG
>probe:Drosophila_2:1629935_at:390:11; Interrogation_Position=600; Antisense; ATATAACGCGTATACGACCTGTCGC
>probe:Drosophila_2:1629935_at:670:37; Interrogation_Position=631; Antisense; ATCTACTGCACTTTGGTTGACGGAA
>probe:Drosophila_2:1629935_at:100:729; Interrogation_Position=657; Antisense; TTGGATTGGCCAGACCTACACTTGT
>probe:Drosophila_2:1629935_at:407:597; Interrogation_Position=679; Antisense; TGTCCGGGATCCATGTACTTCGATA
>probe:Drosophila_2:1629935_at:418:87; Interrogation_Position=703; Antisense; AGTGCCTCCGAGATGTGTGTGTCCA
>probe:Drosophila_2:1629935_at:566:137; Interrogation_Position=787; Antisense; ACGACCAGTAATCCGGAGGCATATT
>probe:Drosophila_2:1629935_at:81:355; Interrogation_Position=860; Antisense; GCACCACGTGTCATCAGTACATCGA
>probe:Drosophila_2:1629935_at:444:487; Interrogation_Position=876; Antisense; GTACATCGACTGTTTTCTGAACGGA
>probe:Drosophila_2:1629935_at:701:237; Interrogation_Position=916; Antisense; AATATGTACACATGTCCCGGTAGCC
>probe:Drosophila_2:1629935_at:294:487; Interrogation_Position=935; Antisense; GTAGCCTCTACTACAACAGTGCCAG
>probe:Drosophila_2:1629935_at:324:87; Interrogation_Position=952; Antisense; AGTGCCAGCAGAACATGTGTCTCCA

Paste this into a BLAST search page for me
ACAGTGGCCAGTTTAACCCTCAATGGATGCCGACCTGTTCGTATAGCGATATCCACTTACTGTGCGGCGGTTCAGATATAACGCGTATACGACCTGTCGCATCTACTGCACTTTGGTTGACGGAATTGGATTGGCCAGACCTACACTTGTTGTCCGGGATCCATGTACTTCGATAAGTGCCTCCGAGATGTGTGTGTCCAACGACCAGTAATCCGGAGGCATATTGCACCACGTGTCATCAGTACATCGAGTACATCGACTGTTTTCTGAACGGAAATATGTACACATGTCCCGGTAGCCGTAGCCTCTACTACAACAGTGCCAGAGTGCCAGCAGAACATGTGTCTCCA

Full Affymetrix probeset data:

Annotations for 1629935_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720