FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629936_at:

>probe:Drosophila_2:1629936_at:50:299; Interrogation_Position=280; Antisense; CGCGGTCCGGAGATGGTGCACAACA
>probe:Drosophila_2:1629936_at:316:659; Interrogation_Position=315; Antisense; TAAGCAGTACGCAATCGTGGCCACT
>probe:Drosophila_2:1629936_at:350:383; Interrogation_Position=402; Antisense; GAACGTCAACACTATGTTCGCCACA
>probe:Drosophila_2:1629936_at:450:131; Interrogation_Position=441; Antisense; ACCCTGGCAGCCGATCACTAAGAAG
>probe:Drosophila_2:1629936_at:123:561; Interrogation_Position=490; Antisense; GGAAAGGGAGCCATCGACCACTACG
>probe:Drosophila_2:1629936_at:631:225; Interrogation_Position=526; Antisense; AAGGCCGGTCGCGTCATTGTCGAGA
>probe:Drosophila_2:1629936_at:168:457; Interrogation_Position=549; Antisense; GATAGCCGGCAAGTGCGAGTTCGTT
>probe:Drosophila_2:1629936_at:309:717; Interrogation_Position=568; Antisense; TTCGTTGAGGTCAAGCAGTTCCTGC
>probe:Drosophila_2:1629936_at:719:479; Interrogation_Position=631; Antisense; GTTTCCCAGGAGATGCTCGACGAAC
>probe:Drosophila_2:1629936_at:103:437; Interrogation_Position=667; Antisense; GAGGAGGAACAGACCCGCCAGAATG
>probe:Drosophila_2:1629936_at:544:419; Interrogation_Position=691; Antisense; GAGAACCCCTTTACCATGAAGTACG
>probe:Drosophila_2:1629936_at:471:489; Interrogation_Position=711; Antisense; GTACGTGATCCAGAACAACCTCAGC
>probe:Drosophila_2:1629936_at:296:471; Interrogation_Position=774; Antisense; GTTCGGCAAGCACCTGTAGATGTAT
>probe:Drosophila_2:1629936_at:258:175; Interrogation_Position=812; Antisense; AAAGCCATCCTTCGTTAATCTGTTA

Paste this into a BLAST search page for me
CGCGGTCCGGAGATGGTGCACAACATAAGCAGTACGCAATCGTGGCCACTGAACGTCAACACTATGTTCGCCACAACCCTGGCAGCCGATCACTAAGAAGGGAAAGGGAGCCATCGACCACTACGAAGGCCGGTCGCGTCATTGTCGAGAGATAGCCGGCAAGTGCGAGTTCGTTTTCGTTGAGGTCAAGCAGTTCCTGCGTTTCCCAGGAGATGCTCGACGAACGAGGAGGAACAGACCCGCCAGAATGGAGAACCCCTTTACCATGAAGTACGGTACGTGATCCAGAACAACCTCAGCGTTCGGCAAGCACCTGTAGATGTATAAAGCCATCCTTCGTTAATCTGTTA

Full Affymetrix probeset data:

Annotations for 1629936_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720