FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629938_at:

>probe:Drosophila_2:1629938_at:96:607; Interrogation_Position=346; Antisense; TGATCCCCGATACCAGCGATTTGCA
>probe:Drosophila_2:1629938_at:333:19; Interrogation_Position=364; Antisense; ATTTGCAGGCAAGTCACGCGGGTCA
>probe:Drosophila_2:1629938_at:257:123; Interrogation_Position=401; Antisense; AGCGCACAATCATGGCGGTGGCTCT
>probe:Drosophila_2:1629938_at:290:269; Interrogation_Position=452; Antisense; CATGGCGTTCCATTTTGGCTACAAC
>probe:Drosophila_2:1629938_at:56:573; Interrogation_Position=468; Antisense; GGCTACAACGAGACGATCCTGTTCT
>probe:Drosophila_2:1629938_at:434:603; Interrogation_Position=487; Antisense; TGTTCTCCTGGTGGCACATCGAAAC
>probe:Drosophila_2:1629938_at:225:481; Interrogation_Position=520; Antisense; GTTTGATCGGCTCCATGATCGCCAT
>probe:Drosophila_2:1629938_at:260:423; Interrogation_Position=567; Antisense; GAGGGACTGAAGTACTACCGCGAGT
>probe:Drosophila_2:1629938_at:320:279; Interrogation_Position=581; Antisense; CTACCGCGAGTATCTATTCTGGAAG
>probe:Drosophila_2:1629938_at:706:39; Interrogation_Position=613; Antisense; ATCTGCTGGAATATCGACCTGTGAC
>probe:Drosophila_2:1629938_at:44:213; Interrogation_Position=647; Antisense; AAGAAATCCGGAGGCACCGCGCATA
>probe:Drosophila_2:1629938_at:237:203; Interrogation_Position=733; Antisense; AACCACCTTCGATGCTGTCGATTAA
>probe:Drosophila_2:1629938_at:207:611; Interrogation_Position=826; Antisense; TGACATACAACGTGTGGCTCTGCCT
>probe:Drosophila_2:1629938_at:107:543; Interrogation_Position=914; Antisense; GGACGTAACCGAGCACTGTCACTAA

Paste this into a BLAST search page for me
TGATCCCCGATACCAGCGATTTGCAATTTGCAGGCAAGTCACGCGGGTCAAGCGCACAATCATGGCGGTGGCTCTCATGGCGTTCCATTTTGGCTACAACGGCTACAACGAGACGATCCTGTTCTTGTTCTCCTGGTGGCACATCGAAACGTTTGATCGGCTCCATGATCGCCATGAGGGACTGAAGTACTACCGCGAGTCTACCGCGAGTATCTATTCTGGAAGATCTGCTGGAATATCGACCTGTGACAAGAAATCCGGAGGCACCGCGCATAAACCACCTTCGATGCTGTCGATTAATGACATACAACGTGTGGCTCTGCCTGGACGTAACCGAGCACTGTCACTAA

Full Affymetrix probeset data:

Annotations for 1629938_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720