FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629940_at:

>probe:Drosophila_2:1629940_at:446:239; Interrogation_Position=1432; Antisense; AATCAGACGAGAACGGCGGCCCAAT
>probe:Drosophila_2:1629940_at:212:331; Interrogation_Position=1447; Antisense; GCGGCCCAATACCATGTGGCTTGAA
>probe:Drosophila_2:1629940_at:4:251; Interrogation_Position=1493; Antisense; CAATGAGTCATTGCCTGAGGATACG
>probe:Drosophila_2:1629940_at:226:545; Interrogation_Position=1511; Antisense; GGATACGGAACTACTTCCAGCCAAT
>probe:Drosophila_2:1629940_at:61:241; Interrogation_Position=1533; Antisense; AATAGTCCCGGTCATTATTCAGAGA
>probe:Drosophila_2:1629940_at:37:15; Interrogation_Position=1546; Antisense; ATTATTCAGAGACCAGCGATGAGGC
>probe:Drosophila_2:1629940_at:208:39; Interrogation_Position=1573; Antisense; ATCTGCCGCGCTGCGTAGAAAGCTA
>probe:Drosophila_2:1629940_at:260:675; Interrogation_Position=1588; Antisense; TAGAAAGCTACAAGGACGCACTGCG
>probe:Drosophila_2:1629940_at:66:143; Interrogation_Position=1607; Antisense; ACTGCGTCTACTGAAGCCCCTGGAG
>probe:Drosophila_2:1629940_at:269:125; Interrogation_Position=1621; Antisense; AGCCCCTGGAGGAATTCGTCCTAAT
>probe:Drosophila_2:1629940_at:711:549; Interrogation_Position=1649; Antisense; GGAGAACTATCGAGCCATTGGCCTG
>probe:Drosophila_2:1629940_at:423:215; Interrogation_Position=1689; Antisense; AAGATCTTTGAGTCCGCTGCGAAAA
>probe:Drosophila_2:1629940_at:527:677; Interrogation_Position=1787; Antisense; TAGATCTTTGAGTACCCTCTGCAGG
>probe:Drosophila_2:1629940_at:599:387; Interrogation_Position=1830; Antisense; GAAAACTGCGTTATTTCACTGAAAA

Paste this into a BLAST search page for me
AATCAGACGAGAACGGCGGCCCAATGCGGCCCAATACCATGTGGCTTGAACAATGAGTCATTGCCTGAGGATACGGGATACGGAACTACTTCCAGCCAATAATAGTCCCGGTCATTATTCAGAGAATTATTCAGAGACCAGCGATGAGGCATCTGCCGCGCTGCGTAGAAAGCTATAGAAAGCTACAAGGACGCACTGCGACTGCGTCTACTGAAGCCCCTGGAGAGCCCCTGGAGGAATTCGTCCTAATGGAGAACTATCGAGCCATTGGCCTGAAGATCTTTGAGTCCGCTGCGAAAATAGATCTTTGAGTACCCTCTGCAGGGAAAACTGCGTTATTTCACTGAAAA

Full Affymetrix probeset data:

Annotations for 1629940_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720