Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629941_a_at:

>probe:Drosophila_2:1629941_a_at:12:169; Interrogation_Position=139; Antisense; AAATGATCGTCAAGATTCCGCGCCA
>probe:Drosophila_2:1629941_a_at:129:305; Interrogation_Position=166; Antisense; CCTACTTCAATGTGCAGGGCGAACG
>probe:Drosophila_2:1629941_a_at:473:487; Interrogation_Position=212; Antisense; GTACCAGGTCCGAAAGTGTCGCGTG
>probe:Drosophila_2:1629941_a_at:269:503; Interrogation_Position=229; Antisense; GTCGCGTGAATCTGGAGCGCATCAA
>probe:Drosophila_2:1629941_a_at:620:445; Interrogation_Position=307; Antisense; GATGCATTGTACGTGTAGCCCGACT
>probe:Drosophila_2:1629941_a_at:102:417; Interrogation_Position=342; Antisense; GAGCGCAGCGAGATTTCCGTGACAC
>probe:Drosophila_2:1629941_a_at:573:313; Interrogation_Position=369; Antisense; GCCAGTTCCATCATGAATTCCGACA
>probe:Drosophila_2:1629941_a_at:442:521; Interrogation_Position=406; Antisense; GTGGCAGCGATCAGGAGTCTAATCT
>probe:Drosophila_2:1629941_a_at:341:285; Interrogation_Position=429; Antisense; CTGACAATCTAGTCGTCTCATACTC
>probe:Drosophila_2:1629941_a_at:1:423; Interrogation_Position=457; Antisense; GAGCAATCAACGCATCCAGCTGACA
>probe:Drosophila_2:1629941_a_at:301:119; Interrogation_Position=474; Antisense; AGCTGACAAACTTCTAATCGCACTT
>probe:Drosophila_2:1629941_a_at:227:235; Interrogation_Position=489; Antisense; AATCGCACTTGGAGTCATTCGAAGT
>probe:Drosophila_2:1629941_a_at:514:523; Interrogation_Position=554; Antisense; GGGCTATCCTTTTCCTGAATATATA
>probe:Drosophila_2:1629941_a_at:616:705; Interrogation_Position=623; Antisense; TTCTTAATACAAACTCGTGCGCCTA

Paste this into a BLAST search page for me
AAATGATCGTCAAGATTCCGCGCCACCTACTTCAATGTGCAGGGCGAACGGTACCAGGTCCGAAAGTGTCGCGTGGTCGCGTGAATCTGGAGCGCATCAAGATGCATTGTACGTGTAGCCCGACTGAGCGCAGCGAGATTTCCGTGACACGCCAGTTCCATCATGAATTCCGACAGTGGCAGCGATCAGGAGTCTAATCTCTGACAATCTAGTCGTCTCATACTCGAGCAATCAACGCATCCAGCTGACAAGCTGACAAACTTCTAATCGCACTTAATCGCACTTGGAGTCATTCGAAGTGGGCTATCCTTTTCCTGAATATATATTCTTAATACAAACTCGTGCGCCTA

Full Affymetrix probeset data:

Annotations for 1629941_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime