FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629942_at:

>probe:Drosophila_2:1629942_at:229:389; Interrogation_Position=1000; Antisense; GAAAACATTAGTGCTCCAGTCATCT
>probe:Drosophila_2:1629942_at:578:265; Interrogation_Position=1016; Antisense; CAGTCATCTGCATCCTGGAGGCATA
>probe:Drosophila_2:1629942_at:602:345; Interrogation_Position=1025; Antisense; GCATCCTGGAGGCATACATCCGAAA
>probe:Drosophila_2:1629942_at:476:657; Interrogation_Position=1056; Antisense; TAAGTACCACTGCATCATTCTTCGA
>probe:Drosophila_2:1629942_at:30:347; Interrogation_Position=1067; Antisense; GCATCATTCTTCGACGATTTCTGTA
>probe:Drosophila_2:1629942_at:451:575; Interrogation_Position=1144; Antisense; GGCGTTCAGAACGTATGTTTTAACT
>probe:Drosophila_2:1629942_at:207:91; Interrogation_Position=599; Antisense; AGTAGGATCAATTGTCGAGGCCAAA
>probe:Drosophila_2:1629942_at:402:599; Interrogation_Position=611; Antisense; TGTCGAGGCCAAAAGCGTGCGTGAA
>probe:Drosophila_2:1629942_at:21:371; Interrogation_Position=648; Antisense; GAATGGAGTCAACCACTGATCCTCA
>probe:Drosophila_2:1629942_at:378:217; Interrogation_Position=742; Antisense; GAATGCAAAAGTCTACGTTTTCGTA
>probe:Drosophila_2:1629942_at:634:245; Interrogation_Position=768; Antisense; AATTCAATTACTTCCAAGCCTTCCA
>probe:Drosophila_2:1629942_at:429:351; Interrogation_Position=825; Antisense; GAAGGCAAACCTCTAGTTTACTCAT
>probe:Drosophila_2:1629942_at:551:559; Interrogation_Position=860; Antisense; GGAACAAGCCAAGAAACGTATTTAT
>probe:Drosophila_2:1629942_at:508:91; Interrogation_Position=899; Antisense; AGTATTCCGTCGAAATCATCGTGAA

Paste this into a BLAST search page for me
GAAAACATTAGTGCTCCAGTCATCTCAGTCATCTGCATCCTGGAGGCATAGCATCCTGGAGGCATACATCCGAAATAAGTACCACTGCATCATTCTTCGAGCATCATTCTTCGACGATTTCTGTAGGCGTTCAGAACGTATGTTTTAACTAGTAGGATCAATTGTCGAGGCCAAATGTCGAGGCCAAAAGCGTGCGTGAAGAATGGAGTCAACCACTGATCCTCAGAATGCAAAAGTCTACGTTTTCGTAAATTCAATTACTTCCAAGCCTTCCAGAAGGCAAACCTCTAGTTTACTCATGGAACAAGCCAAGAAACGTATTTATAGTATTCCGTCGAAATCATCGTGAA

Full Affymetrix probeset data:

Annotations for 1629942_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720