FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629943_at:

>probe:Drosophila_2:1629943_at:125:319; Interrogation_Position=3117; Antisense; GCCGAGTGCAAGAACCAGGACCTGA
>probe:Drosophila_2:1629943_at:474:35; Interrogation_Position=3145; Antisense; ATCAGCTCAGCAATACGCTCAGTGA
>probe:Drosophila_2:1629943_at:716:511; Interrogation_Position=3166; Antisense; GTGAGCTGCAAACCAACCGCAACAG
>probe:Drosophila_2:1629943_at:136:125; Interrogation_Position=3196; Antisense; AGCCCTGGCTATCGAAGACCTTCAA
>probe:Drosophila_2:1629943_at:396:103; Interrogation_Position=3211; Antisense; AGACCTTCAATTCGCTGCAGGAGAA
>probe:Drosophila_2:1629943_at:245:9; Interrogation_Position=3290; Antisense; ATTCCAATCCTACATGGGCCAGGCG
>probe:Drosophila_2:1629943_at:657:659; Interrogation_Position=3358; Antisense; TAACCTAGAGTCCAGTGATCCGGCC
>probe:Drosophila_2:1629943_at:55:449; Interrogation_Position=3374; Antisense; GATCCGGCCAACTGTTATGACTGAA
>probe:Drosophila_2:1629943_at:130:25; Interrogation_Position=3452; Antisense; ATATGGGTTATCAGCCCACGAGCTG
>probe:Drosophila_2:1629943_at:33:697; Interrogation_Position=3534; Antisense; TTTAATTACGCGCTTAACCTCACAC
>probe:Drosophila_2:1629943_at:628:695; Interrogation_Position=3583; Antisense; TTTAGTCGACTCTATGCAGGCATTG
>probe:Drosophila_2:1629943_at:716:283; Interrogation_Position=3615; Antisense; CTGCTGTTTCTGTTAGTACCCTAAA
>probe:Drosophila_2:1629943_at:378:133; Interrogation_Position=3640; Antisense; ACCCGGGTTGCTTATGATTTTATTG
>probe:Drosophila_2:1629943_at:642:327; Interrogation_Position=3672; Antisense; GCGTTGCAAATAAAACCCCGTGTAT

Paste this into a BLAST search page for me
GCCGAGTGCAAGAACCAGGACCTGAATCAGCTCAGCAATACGCTCAGTGAGTGAGCTGCAAACCAACCGCAACAGAGCCCTGGCTATCGAAGACCTTCAAAGACCTTCAATTCGCTGCAGGAGAAATTCCAATCCTACATGGGCCAGGCGTAACCTAGAGTCCAGTGATCCGGCCGATCCGGCCAACTGTTATGACTGAAATATGGGTTATCAGCCCACGAGCTGTTTAATTACGCGCTTAACCTCACACTTTAGTCGACTCTATGCAGGCATTGCTGCTGTTTCTGTTAGTACCCTAAAACCCGGGTTGCTTATGATTTTATTGGCGTTGCAAATAAAACCCCGTGTAT

Full Affymetrix probeset data:

Annotations for 1629943_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720