FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629944_at:

>probe:Drosophila_2:1629944_at:668:571; Interrogation_Position=311; Antisense; GGCTGCCCCTATGATTCGAAGATCA
>probe:Drosophila_2:1629944_at:231:295; Interrogation_Position=327; Antisense; CGAAGATCATCAGCCGTTTTGTGCC
>probe:Drosophila_2:1629944_at:356:637; Interrogation_Position=389; Antisense; TCGATGTTCAAGTTCCCCGAGGGAT
>probe:Drosophila_2:1629944_at:218:443; Interrogation_Position=434; Antisense; GATGTGATCCAGTGCTATGGTCGCT
>probe:Drosophila_2:1629944_at:72:57; Interrogation_Position=471; Antisense; ATGACTGCAACGACGTGGCTCTGGC
>probe:Drosophila_2:1629944_at:122:585; Interrogation_Position=562; Antisense; TGGAACCACTGTCTTTGTGCTCGAT
>probe:Drosophila_2:1629944_at:357:95; Interrogation_Position=638; Antisense; AGTTGGCTGCTGTGGCTAACCATCA
>probe:Drosophila_2:1629944_at:152:147; Interrogation_Position=673; Antisense; ACTCTTCCTGATCATGTTGCTGATG
>probe:Drosophila_2:1629944_at:435:467; Interrogation_Position=688; Antisense; GTTGCTGATGAACATCTTCCTCTGC
>probe:Drosophila_2:1629944_at:210:315; Interrogation_Position=716; Antisense; GCCATGAGCTGCAGTTGTGCCAATA
>probe:Drosophila_2:1629944_at:236:449; Interrogation_Position=782; Antisense; GATCCGTATCGCAGTTGGCATGGCA
>probe:Drosophila_2:1629944_at:685:583; Interrogation_Position=802; Antisense; TGGCAGTCAGTACGGATCACGCTAC
>probe:Drosophila_2:1629944_at:35:135; Interrogation_Position=820; Antisense; ACGCTACTCGCTCCATGGAAGGGAT
>probe:Drosophila_2:1629944_at:301:533; Interrogation_Position=866; Antisense; GGTGGCTCCACGATACACTCAAATA

Paste this into a BLAST search page for me
GGCTGCCCCTATGATTCGAAGATCACGAAGATCATCAGCCGTTTTGTGCCTCGATGTTCAAGTTCCCCGAGGGATGATGTGATCCAGTGCTATGGTCGCTATGACTGCAACGACGTGGCTCTGGCTGGAACCACTGTCTTTGTGCTCGATAGTTGGCTGCTGTGGCTAACCATCAACTCTTCCTGATCATGTTGCTGATGGTTGCTGATGAACATCTTCCTCTGCGCCATGAGCTGCAGTTGTGCCAATAGATCCGTATCGCAGTTGGCATGGCATGGCAGTCAGTACGGATCACGCTACACGCTACTCGCTCCATGGAAGGGATGGTGGCTCCACGATACACTCAAATA

Full Affymetrix probeset data:

Annotations for 1629944_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720