FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629947_at:

>probe:Drosophila_2:1629947_at:517:323; Interrogation_Position=242; Antisense; GCGCGCGTATCGGTTTCAAGCAGTT
>probe:Drosophila_2:1629947_at:208:209; Interrogation_Position=259; Antisense; AAGCAGTTCGTGGACACTTGCTCCA
>probe:Drosophila_2:1629947_at:711:535; Interrogation_Position=291; Antisense; GGTGCCACAGTTTGGACGCGGTTCA
>probe:Drosophila_2:1629947_at:712:323; Interrogation_Position=326; Antisense; GCGACGGGCGTGTTCAGAAGCTTCA
>probe:Drosophila_2:1629947_at:329:109; Interrogation_Position=341; Antisense; AGAAGCTTCAACTCCTGTCCAAGAT
>probe:Drosophila_2:1629947_at:44:61; Interrogation_Position=364; Antisense; ATGTTTGACACGAGGCGCAGCGGCT
>probe:Drosophila_2:1629947_at:64:117; Interrogation_Position=424; Antisense; AGCATTGTCAATCTGGCCTGGAGTC
>probe:Drosophila_2:1629947_at:206:693; Interrogation_Position=479; Antisense; TTTCCGAGAACCGTTTGCCTGAGGT
>probe:Drosophila_2:1629947_at:106:359; Interrogation_Position=516; Antisense; GCAACTTTTAGAGCATCAGGCCTTT
>probe:Drosophila_2:1629947_at:420:693; Interrogation_Position=544; Antisense; TTCTGCTGCGACCATATCTCATATG
>probe:Drosophila_2:1629947_at:529:205; Interrogation_Position=580; Antisense; AAGCGCCTGTTTAGTGTGGACGTCG
>probe:Drosophila_2:1629947_at:616:399; Interrogation_Position=604; Antisense; GACAGACGGCTGTCGATCGCCAAGT
>probe:Drosophila_2:1629947_at:509:315; Interrogation_Position=649; Antisense; GCCGATGCCGAGATGGTACTGCCAG
>probe:Drosophila_2:1629947_at:569:677; Interrogation_Position=95; Antisense; TAGAGCAGCTGCACACGCGGTTCCG

Paste this into a BLAST search page for me
GCGCGCGTATCGGTTTCAAGCAGTTAAGCAGTTCGTGGACACTTGCTCCAGGTGCCACAGTTTGGACGCGGTTCAGCGACGGGCGTGTTCAGAAGCTTCAAGAAGCTTCAACTCCTGTCCAAGATATGTTTGACACGAGGCGCAGCGGCTAGCATTGTCAATCTGGCCTGGAGTCTTTCCGAGAACCGTTTGCCTGAGGTGCAACTTTTAGAGCATCAGGCCTTTTTCTGCTGCGACCATATCTCATATGAAGCGCCTGTTTAGTGTGGACGTCGGACAGACGGCTGTCGATCGCCAAGTGCCGATGCCGAGATGGTACTGCCAGTAGAGCAGCTGCACACGCGGTTCCG

Full Affymetrix probeset data:

Annotations for 1629947_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720