FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629948_at:

>probe:Drosophila_2:1629948_at:104:15; Interrogation_Position=1046; Antisense; ATTTTCGTAATCACCACACTCAACT
>probe:Drosophila_2:1629948_at:658:141; Interrogation_Position=1068; Antisense; ACTGACCGATTGGACGTTCTTTTTG
>probe:Drosophila_2:1629948_at:491:661; Interrogation_Position=560; Antisense; TAAAACACTTTGACCTTGACCACTC
>probe:Drosophila_2:1629948_at:122:723; Interrogation_Position=575; Antisense; TTGACCACTCAGTAACAGTCCGAAA
>probe:Drosophila_2:1629948_at:519:187; Interrogation_Position=641; Antisense; AACACGCCTTCACCGAAATTTGGAT
>probe:Drosophila_2:1629948_at:704:463; Interrogation_Position=667; Antisense; GATTCGCAGCAGAAACCTTGCCAGG
>probe:Drosophila_2:1629948_at:418:223; Interrogation_Position=694; Antisense; AAGGTTTCTCGCTTGCAGCAGTTTT
>probe:Drosophila_2:1629948_at:719:351; Interrogation_Position=708; Antisense; GCAGCAGTTTTCTATGGCCCTGGAG
>probe:Drosophila_2:1629948_at:82:549; Interrogation_Position=729; Antisense; GGAGGCCTATTTTGACCAGGATTCT
>probe:Drosophila_2:1629948_at:354:133; Interrogation_Position=787; Antisense; ACGCCTGCTCCGAAAAGTGACAAAC
>probe:Drosophila_2:1629948_at:130:373; Interrogation_Position=819; Antisense; GAAGGTGGTGTATGTGTCTCCCTTT
>probe:Drosophila_2:1629948_at:123:417; Interrogation_Position=891; Antisense; GAGCGGAGTTAAGCCACCCAATATA
>probe:Drosophila_2:1629948_at:393:261; Interrogation_Position=920; Antisense; CAGCTGGCTTTGATTTGACCCGATT
>probe:Drosophila_2:1629948_at:24:325; Interrogation_Position=990; Antisense; GCGCACTGGCGATAGCATATAAACT

Paste this into a BLAST search page for me
ATTTTCGTAATCACCACACTCAACTACTGACCGATTGGACGTTCTTTTTGTAAAACACTTTGACCTTGACCACTCTTGACCACTCAGTAACAGTCCGAAAAACACGCCTTCACCGAAATTTGGATGATTCGCAGCAGAAACCTTGCCAGGAAGGTTTCTCGCTTGCAGCAGTTTTGCAGCAGTTTTCTATGGCCCTGGAGGGAGGCCTATTTTGACCAGGATTCTACGCCTGCTCCGAAAAGTGACAAACGAAGGTGGTGTATGTGTCTCCCTTTGAGCGGAGTTAAGCCACCCAATATACAGCTGGCTTTGATTTGACCCGATTGCGCACTGGCGATAGCATATAAACT

Full Affymetrix probeset data:

Annotations for 1629948_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720