Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629949_at:

>probe:Drosophila_2:1629949_at:425:409; Interrogation_Position=1052; Antisense; GACGCGGAGCTTACCCTAATGGTGA
>probe:Drosophila_2:1629949_at:393:229; Interrogation_Position=1069; Antisense; AATGGTGACCCCATTGCACATGTCA
>probe:Drosophila_2:1629949_at:574:721; Interrogation_Position=1082; Antisense; TTGCACATGTCACAGGCCATACGAT
>probe:Drosophila_2:1629949_at:593:671; Interrogation_Position=1101; Antisense; TACGATGATATCTTGGTTGGCACCT
>probe:Drosophila_2:1629949_at:447:541; Interrogation_Position=1115; Antisense; GGTTGGCACCTATCACTAATATTAC
>probe:Drosophila_2:1629949_at:463:91; Interrogation_Position=660; Antisense; AGTATGCCAACATGTCTCACTGCAA
>probe:Drosophila_2:1629949_at:328:17; Interrogation_Position=684; Antisense; ATTTGTCCCACACCAATCTTAACTA
>probe:Drosophila_2:1629949_at:434:659; Interrogation_Position=703; Antisense; TAACTACTGCTGTCTTGAACGGGCG
>probe:Drosophila_2:1629949_at:226:541; Interrogation_Position=718; Antisense; TGAACGGGCGGATCTTCAGTACGCA
>probe:Drosophila_2:1629949_at:201:63; Interrogation_Position=751; Antisense; ATGTGCCCAACTAGTGTCAGTGCGG
>probe:Drosophila_2:1629949_at:713:375; Interrogation_Position=824; Antisense; GAAGACCCAACAGGAGTTCGAACTA
>probe:Drosophila_2:1629949_at:644:261; Interrogation_Position=895; Antisense; CATGGCCGGTGTTAACTTACGTGTG
>probe:Drosophila_2:1629949_at:369:281; Interrogation_Position=949; Antisense; CTGTAATTTGCGAGCTGCGGTGTTA
>probe:Drosophila_2:1629949_at:215:55; Interrogation_Position=994; Antisense; ATGCAATCTTTCTGGCAGCGACTTG

Paste this into a BLAST search page for me
GACGCGGAGCTTACCCTAATGGTGAAATGGTGACCCCATTGCACATGTCATTGCACATGTCACAGGCCATACGATTACGATGATATCTTGGTTGGCACCTGGTTGGCACCTATCACTAATATTACAGTATGCCAACATGTCTCACTGCAAATTTGTCCCACACCAATCTTAACTATAACTACTGCTGTCTTGAACGGGCGTGAACGGGCGGATCTTCAGTACGCAATGTGCCCAACTAGTGTCAGTGCGGGAAGACCCAACAGGAGTTCGAACTACATGGCCGGTGTTAACTTACGTGTGCTGTAATTTGCGAGCTGCGGTGTTAATGCAATCTTTCTGGCAGCGACTTG

Full Affymetrix probeset data:

Annotations for 1629949_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime