FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629950_at:

>probe:Drosophila_2:1629950_at:604:23; Interrogation_Position=1289; Antisense; ATATCGCCGGAAATCTGCGCAACGT
>probe:Drosophila_2:1629950_at:583:101; Interrogation_Position=1322; Antisense; AGAGCAGTCTGCTGAAGGACCGCTT
>probe:Drosophila_2:1629950_at:196:243; Interrogation_Position=1366; Antisense; AATATGTTGCCCACGACAAAGCTCG
>probe:Drosophila_2:1629950_at:159:399; Interrogation_Position=1380; Antisense; GACAAAGCTCGTCAGCCGCAAGAAG
>probe:Drosophila_2:1629950_at:730:85; Interrogation_Position=1403; Antisense; AGTCCAAGGTCAAGCGCTTCGAGCG
>probe:Drosophila_2:1629950_at:549:317; Interrogation_Position=1443; Antisense; GCCGGGCGTTAGCTATAATGACCTC
>probe:Drosophila_2:1629950_at:347:657; Interrogation_Position=1458; Antisense; TAATGACCTCAAGGAACGGCGCAGG
>probe:Drosophila_2:1629950_at:76:227; Interrogation_Position=1501; Antisense; AAGGCTACTGCCAATATCAAGATAT
>probe:Drosophila_2:1629950_at:250:383; Interrogation_Position=1632; Antisense; GAACTCTAGATCAGGGACTTGCCCT
>probe:Drosophila_2:1629950_at:74:145; Interrogation_Position=1658; Antisense; ACTGCGTCTCTGTTTCGGATTGTTC
>probe:Drosophila_2:1629950_at:597:463; Interrogation_Position=1675; Antisense; GATTGTTCTTCTTTTTCTTCTTGGA
>probe:Drosophila_2:1629950_at:618:701; Interrogation_Position=1687; Antisense; TTTTCTTCTTGGACAGCGGAGCTGC
>probe:Drosophila_2:1629950_at:117:135; Interrogation_Position=1727; Antisense; ACGCGTCTCGATTGGTCCATCCAGT
>probe:Drosophila_2:1629950_at:308:501; Interrogation_Position=1750; Antisense; GTCGCTTTACGCCACTGAAACGAAA

Paste this into a BLAST search page for me
ATATCGCCGGAAATCTGCGCAACGTAGAGCAGTCTGCTGAAGGACCGCTTAATATGTTGCCCACGACAAAGCTCGGACAAAGCTCGTCAGCCGCAAGAAGAGTCCAAGGTCAAGCGCTTCGAGCGGCCGGGCGTTAGCTATAATGACCTCTAATGACCTCAAGGAACGGCGCAGGAAGGCTACTGCCAATATCAAGATATGAACTCTAGATCAGGGACTTGCCCTACTGCGTCTCTGTTTCGGATTGTTCGATTGTTCTTCTTTTTCTTCTTGGATTTTCTTCTTGGACAGCGGAGCTGCACGCGTCTCGATTGGTCCATCCAGTGTCGCTTTACGCCACTGAAACGAAA

Full Affymetrix probeset data:

Annotations for 1629950_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720