FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629951_at:

>probe:Drosophila_2:1629951_at:107:193; Interrogation_Position=1012; Antisense; AACTGATCCGCTGGGAGGGTTACCT
>probe:Drosophila_2:1629951_at:324:427; Interrogation_Position=1066; Antisense; GAGAGGCTTACCAACACTGTGATTT
>probe:Drosophila_2:1629951_at:686:59; Interrogation_Position=1117; Antisense; ATGTTTGTCAGTTTGTCTTACCGTA
>probe:Drosophila_2:1629951_at:428:705; Interrogation_Position=590; Antisense; TTCAGAGCGTTCTGGTGAACTCCCA
>probe:Drosophila_2:1629951_at:494:579; Interrogation_Position=651; Antisense; GGCCATTGCCGAAATAGTGCTCACC
>probe:Drosophila_2:1629951_at:125:649; Interrogation_Position=671; Antisense; TCACCTTCTCTATGGAACTGGGCGA
>probe:Drosophila_2:1629951_at:97:155; Interrogation_Position=734; Antisense; ACAGTGGCTGGCTGGTGGACTCCTA
>probe:Drosophila_2:1629951_at:60:207; Interrogation_Position=775; Antisense; AAGCTGATCAGCTTCAGTCCGAAAA
>probe:Drosophila_2:1629951_at:182:197; Interrogation_Position=805; Antisense; AACCTTCGCGTTATTGACTTTCTGA
>probe:Drosophila_2:1629951_at:657:541; Interrogation_Position=834; Antisense; GGTTCGACAGAAGTAGCCCACAAAT
>probe:Drosophila_2:1629951_at:135:253; Interrogation_Position=854; Antisense; CAAATTCTCCGTTCCGAAGGTGTTG
>probe:Drosophila_2:1629951_at:344:43; Interrogation_Position=930; Antisense; ATCCCTCGCATTGGCATTACGTTAA
>probe:Drosophila_2:1629951_at:13:149; Interrogation_Position=947; Antisense; TACGTTAAACCCACTTTGTCAGCGA
>probe:Drosophila_2:1629951_at:505:403; Interrogation_Position=995; Antisense; GACTCCGCTTCGATGTGAACTGATC

Paste this into a BLAST search page for me
AACTGATCCGCTGGGAGGGTTACCTGAGAGGCTTACCAACACTGTGATTTATGTTTGTCAGTTTGTCTTACCGTATTCAGAGCGTTCTGGTGAACTCCCAGGCCATTGCCGAAATAGTGCTCACCTCACCTTCTCTATGGAACTGGGCGAACAGTGGCTGGCTGGTGGACTCCTAAAGCTGATCAGCTTCAGTCCGAAAAAACCTTCGCGTTATTGACTTTCTGAGGTTCGACAGAAGTAGCCCACAAATCAAATTCTCCGTTCCGAAGGTGTTGATCCCTCGCATTGGCATTACGTTAATACGTTAAACCCACTTTGTCAGCGAGACTCCGCTTCGATGTGAACTGATC

Full Affymetrix probeset data:

Annotations for 1629951_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720