FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629952_at:

>probe:Drosophila_2:1629952_at:670:671; Interrogation_Position=289; Antisense; TACGAGGATCTTCCGATGGCGACTG
>probe:Drosophila_2:1629952_at:591:623; Interrogation_Position=357; Antisense; TGCGAACAATTTTATGCCCCAGCTT
>probe:Drosophila_2:1629952_at:45:117; Interrogation_Position=467; Antisense; AGCATAATTTCTGCCTGGAGCTGCA
>probe:Drosophila_2:1629952_at:67:37; Interrogation_Position=548; Antisense; ATCTCTTTGCACTGAGTCACGTCAA
>probe:Drosophila_2:1629952_at:471:349; Interrogation_Position=588; Antisense; GCAGGTCACCGATCATCTCAAATGG
>probe:Drosophila_2:1629952_at:151:229; Interrogation_Position=608; Antisense; AATGGATCTCGCAGCCAGGATCATC
>probe:Drosophila_2:1629952_at:403:77; Interrogation_Position=624; Antisense; AGGATCATCGATTGAGCTTCCACCC
>probe:Drosophila_2:1629952_at:275:429; Interrogation_Position=658; Antisense; GAGTCACTACTTCAACCATTCGGAT
>probe:Drosophila_2:1629952_at:620:405; Interrogation_Position=680; Antisense; GATCTGGTTACTTTTCCTACGAGGG
>probe:Drosophila_2:1629952_at:324:137; Interrogation_Position=698; Antisense; ACGAGGGCACCTACGACAACGGAGA
>probe:Drosophila_2:1629952_at:596:395; Interrogation_Position=712; Antisense; GACAACGGAGATGTCGTTCTGCCCA
>probe:Drosophila_2:1629952_at:599:657; Interrogation_Position=756; Antisense; TAAGATATCCGTGGTCGACTCGCGT
>probe:Drosophila_2:1629952_at:215:467; Interrogation_Position=783; Antisense; GTTGTCCGAGTTTGAGGCACTGTAC
>probe:Drosophila_2:1629952_at:99:263; Interrogation_Position=850; Antisense; CAGCCCTTGGGCAATCGTAATGTGT

Paste this into a BLAST search page for me
TACGAGGATCTTCCGATGGCGACTGTGCGAACAATTTTATGCCCCAGCTTAGCATAATTTCTGCCTGGAGCTGCAATCTCTTTGCACTGAGTCACGTCAAGCAGGTCACCGATCATCTCAAATGGAATGGATCTCGCAGCCAGGATCATCAGGATCATCGATTGAGCTTCCACCCGAGTCACTACTTCAACCATTCGGATGATCTGGTTACTTTTCCTACGAGGGACGAGGGCACCTACGACAACGGAGAGACAACGGAGATGTCGTTCTGCCCATAAGATATCCGTGGTCGACTCGCGTGTTGTCCGAGTTTGAGGCACTGTACCAGCCCTTGGGCAATCGTAATGTGT

Full Affymetrix probeset data:

Annotations for 1629952_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720