Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629953_at:

>probe:Drosophila_2:1629953_at:323:111; Interrogation_Position=1213; Antisense; AGCAACTTGGCTAACGCTACTGCAG
>probe:Drosophila_2:1629953_at:157:339; Interrogation_Position=1228; Antisense; GCTACTGCAGCAAACTCGGGCATCA
>probe:Drosophila_2:1629953_at:20:255; Interrogation_Position=1467; Antisense; CTAAAGGTCCACTCCTCTCTTGATG
>probe:Drosophila_2:1629953_at:682:143; Interrogation_Position=1477; Antisense; ACTCCTCTCTTGATGCGTTGAACGC
>probe:Drosophila_2:1629953_at:29:623; Interrogation_Position=1490; Antisense; TGCGTTGAACGCGAGGATCCGAATC
>probe:Drosophila_2:1629953_at:662:449; Interrogation_Position=1505; Antisense; GATCCGAATCGTATGTCCAGTTTTT
>probe:Drosophila_2:1629953_at:377:483; Interrogation_Position=1515; Antisense; GTATGTCCAGTTTTTGGGTCAGCTT
>probe:Drosophila_2:1629953_at:372:531; Interrogation_Position=1530; Antisense; GGGTCAGCTTATCTGTGAATAGTTT
>probe:Drosophila_2:1629953_at:353:157; Interrogation_Position=1581; Antisense; ACACGCTCGCATTTAAGTACTTTAA
>probe:Drosophila_2:1629953_at:664:645; Interrogation_Position=1603; Antisense; TAAGTCCTTGGAGTATACGTTATAT
>probe:Drosophila_2:1629953_at:333:481; Interrogation_Position=1637; Antisense; GTATTAGCTGTAGTGCATCTCGCAA
>probe:Drosophila_2:1629953_at:258:635; Interrogation_Position=1656; Antisense; TCGCAATCCCACCAGTTAACTATCA
>probe:Drosophila_2:1629953_at:241:95; Interrogation_Position=1695; Antisense; AGTTGTAGAAGTCCCAGCTAGCTAT
>probe:Drosophila_2:1629953_at:571:633; Interrogation_Position=1706; Antisense; TCCCAGCTAGCTATTAATGTTTAAC

Paste this into a BLAST search page for me
AGCAACTTGGCTAACGCTACTGCAGGCTACTGCAGCAAACTCGGGCATCACTAAAGGTCCACTCCTCTCTTGATGACTCCTCTCTTGATGCGTTGAACGCTGCGTTGAACGCGAGGATCCGAATCGATCCGAATCGTATGTCCAGTTTTTGTATGTCCAGTTTTTGGGTCAGCTTGGGTCAGCTTATCTGTGAATAGTTTACACGCTCGCATTTAAGTACTTTAATAAGTCCTTGGAGTATACGTTATATGTATTAGCTGTAGTGCATCTCGCAATCGCAATCCCACCAGTTAACTATCAAGTTGTAGAAGTCCCAGCTAGCTATTCCCAGCTAGCTATTAATGTTTAAC

Full Affymetrix probeset data:

Annotations for 1629953_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime