FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629955_at:

>probe:Drosophila_2:1629955_at:497:175; Interrogation_Position=107; Antisense; AAACGGAGTTTCAGTTCTGCTCCTC
>probe:Drosophila_2:1629955_at:559:309; Interrogation_Position=167; Antisense; CCACCGGTTACTACTGCACAGAGAG
>probe:Drosophila_2:1629955_at:177:625; Interrogation_Position=17; Antisense; TGCGCCTACTGATCGTTTTGGGATT
>probe:Drosophila_2:1629955_at:179:569; Interrogation_Position=213; Antisense; GGCATCTTCGGCAGGTTGTACAGGA
>probe:Drosophila_2:1629955_at:507:543; Interrogation_Position=255; Antisense; GGATAATCGTTTTGCTTGCACCGGT
>probe:Drosophila_2:1629955_at:368:693; Interrogation_Position=289; Antisense; TTTGCGCTGTGCCTAGGTACTTCTA
>probe:Drosophila_2:1629955_at:219:715; Interrogation_Position=309; Antisense; TTCTACACCCAGTACATCGATTGGC
>probe:Drosophila_2:1629955_at:465:3; Interrogation_Position=328; Antisense; ATTGGCGGAAGCTGTGGCACTAATT
>probe:Drosophila_2:1629955_at:256:461; Interrogation_Position=38; Antisense; GATTTTATATCCTGGGCTGCCGAGC
>probe:Drosophila_2:1629955_at:693:483; Interrogation_Position=406; Antisense; GTATCCTGTTCCACATCAAGTACGT
>probe:Drosophila_2:1629955_at:224:105; Interrogation_Position=432; Antisense; AGACTGCGATACTACGGCCATCAAA
>probe:Drosophila_2:1629955_at:166:233; Interrogation_Position=457; Antisense; AATGCCACCGAGTATTGTCAAACCA
>probe:Drosophila_2:1629955_at:356:703; Interrogation_Position=504; Antisense; TTATGGCGGAGATACCTCAACCACC
>probe:Drosophila_2:1629955_at:112:339; Interrogation_Position=82; Antisense; GCTAATGGCGTGTCCTGTATATCGG

Paste this into a BLAST search page for me
AAACGGAGTTTCAGTTCTGCTCCTCCCACCGGTTACTACTGCACAGAGAGTGCGCCTACTGATCGTTTTGGGATTGGCATCTTCGGCAGGTTGTACAGGAGGATAATCGTTTTGCTTGCACCGGTTTTGCGCTGTGCCTAGGTACTTCTATTCTACACCCAGTACATCGATTGGCATTGGCGGAAGCTGTGGCACTAATTGATTTTATATCCTGGGCTGCCGAGCGTATCCTGTTCCACATCAAGTACGTAGACTGCGATACTACGGCCATCAAAAATGCCACCGAGTATTGTCAAACCATTATGGCGGAGATACCTCAACCACCGCTAATGGCGTGTCCTGTATATCGG

Full Affymetrix probeset data:

Annotations for 1629955_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720