Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629956_at:

>probe:Drosophila_2:1629956_at:628:469; Interrogation_Position=1007; Antisense; GTTGCTGCACAAGCTACACTCGCAA
>probe:Drosophila_2:1629956_at:98:421; Interrogation_Position=1050; Antisense; GAGCACTTGCGCAGCTTGGAGCTCT
>probe:Drosophila_2:1629956_at:136:307; Interrogation_Position=1075; Antisense; CCTGCGTGGACGAGCTAAATAACTA
>probe:Drosophila_2:1629956_at:150:643; Interrogation_Position=1102; Antisense; TCTCTCTGCAGGATCACGCCAGTGA
>probe:Drosophila_2:1629956_at:513:493; Interrogation_Position=1167; Antisense; GTCAAGTTCTATCGCTAGACCAACG
>probe:Drosophila_2:1629956_at:248:543; Interrogation_Position=1206; Antisense; GGATACTCCAAAAACTAGCTTGCAA
>probe:Drosophila_2:1629956_at:104:419; Interrogation_Position=1239; Antisense; GAGCATCGGGATTTGACTTGAGCAT
>probe:Drosophila_2:1629956_at:300:403; Interrogation_Position=1253; Antisense; GACTTGAGCATTCTTATGGCATTAC
>probe:Drosophila_2:1629956_at:305:543; Interrogation_Position=1270; Antisense; GGCATTACCAAATAGGCTTTAGTCG
>probe:Drosophila_2:1629956_at:254:687; Interrogation_Position=1301; Antisense; TATTTTCTTGTGCAATCTCTACTGA
>probe:Drosophila_2:1629956_at:579:11; Interrogation_Position=1377; Antisense; ATTCTGTCTCAGTGGGCAATCTCCG
>probe:Drosophila_2:1629956_at:241:527; Interrogation_Position=1390; Antisense; GGGCAATCTCCGACTTGAATTTAAA
>probe:Drosophila_2:1629956_at:663:687; Interrogation_Position=1419; Antisense; TATTGTGTGACATTCCAGGCTTAGT
>probe:Drosophila_2:1629956_at:632:377; Interrogation_Position=993; Antisense; GAAGCGGACTTGACGTTGCTGCACA

Paste this into a BLAST search page for me
GTTGCTGCACAAGCTACACTCGCAAGAGCACTTGCGCAGCTTGGAGCTCTCCTGCGTGGACGAGCTAAATAACTATCTCTCTGCAGGATCACGCCAGTGAGTCAAGTTCTATCGCTAGACCAACGGGATACTCCAAAAACTAGCTTGCAAGAGCATCGGGATTTGACTTGAGCATGACTTGAGCATTCTTATGGCATTACGGCATTACCAAATAGGCTTTAGTCGTATTTTCTTGTGCAATCTCTACTGAATTCTGTCTCAGTGGGCAATCTCCGGGGCAATCTCCGACTTGAATTTAAATATTGTGTGACATTCCAGGCTTAGTGAAGCGGACTTGACGTTGCTGCACA

Full Affymetrix probeset data:

Annotations for 1629956_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime