Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629958_at:

>probe:Drosophila_2:1629958_at:135:597; Interrogation_Position=567; Antisense; TGTGCCCTACACAAGTAAGGCTATT
>probe:Drosophila_2:1629958_at:346:657; Interrogation_Position=582; Antisense; TAAGGCTATTAGAACACGGCGCAGG
>probe:Drosophila_2:1629958_at:90:569; Interrogation_Position=585; Antisense; GGCTATTAGAACACGGCGCAGGCTA
>probe:Drosophila_2:1629958_at:464:107; Interrogation_Position=592; Antisense; AGAACACGGCGCAGGCTACAGGCTT
>probe:Drosophila_2:1629958_at:730:141; Interrogation_Position=597; Antisense; ACGGCGCAGGCTACAGGCTTCATGA
>probe:Drosophila_2:1629958_at:571:347; Interrogation_Position=602; Antisense; GCAGGCTACAGGCTTCATGAGCGAA
>probe:Drosophila_2:1629958_at:246:267; Interrogation_Position=610; Antisense; CAGGCTTCATGAGCGAAAAACAGAT
>probe:Drosophila_2:1629958_at:410:455; Interrogation_Position=632; Antisense; GATAAATCGAATGATCTAGTTAGAA
>probe:Drosophila_2:1629958_at:45:185; Interrogation_Position=655; Antisense; AAAATAGAGATTTGCCGGCGGTGCC
>probe:Drosophila_2:1629958_at:439:317; Interrogation_Position=668; Antisense; GCCGGCGGTGCCAATTTTTATGAGC
>probe:Drosophila_2:1629958_at:417:535; Interrogation_Position=674; Antisense; GGTGCCAATTTTTATGAGCATTCCC
>probe:Drosophila_2:1629958_at:400:311; Interrogation_Position=677; Antisense; GCCAATTTTTATGAGCATTCCCATA
>probe:Drosophila_2:1629958_at:435:609; Interrogation_Position=688; Antisense; TGAGCATTCCCATATAGAAAAGCTT
>probe:Drosophila_2:1629958_at:126:257; Interrogation_Position=696; Antisense; CCCATATAGAAAAGCTTTACGCCCA

Paste this into a BLAST search page for me
TGTGCCCTACACAAGTAAGGCTATTTAAGGCTATTAGAACACGGCGCAGGGGCTATTAGAACACGGCGCAGGCTAAGAACACGGCGCAGGCTACAGGCTTACGGCGCAGGCTACAGGCTTCATGAGCAGGCTACAGGCTTCATGAGCGAACAGGCTTCATGAGCGAAAAACAGATGATAAATCGAATGATCTAGTTAGAAAAAATAGAGATTTGCCGGCGGTGCCGCCGGCGGTGCCAATTTTTATGAGCGGTGCCAATTTTTATGAGCATTCCCGCCAATTTTTATGAGCATTCCCATATGAGCATTCCCATATAGAAAAGCTTCCCATATAGAAAAGCTTTACGCCCA

Full Affymetrix probeset data:

Annotations for 1629958_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime