FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629959_at:

>probe:Drosophila_2:1629959_at:506:251; Interrogation_Position=106; Antisense; CAAGGATCGCGTTATTTACCACCAC
>probe:Drosophila_2:1629959_at:247:209; Interrogation_Position=160; Antisense; AAGCAGTTTTACAGCATATCACCCG
>probe:Drosophila_2:1629959_at:90:35; Interrogation_Position=177; Antisense; ATCACCCGCCGAAGATCCTGAGGAT
>probe:Drosophila_2:1629959_at:433:389; Interrogation_Position=216; Antisense; GAAACACTTGGTGATCGGACAGCCA
>probe:Drosophila_2:1629959_at:243:399; Interrogation_Position=233; Antisense; GACAGCCACGCAGGAATTACCGAGT
>probe:Drosophila_2:1629959_at:604:21; Interrogation_Position=300; Antisense; ATATACGGCGGAGTTGGCACCTCAG
>probe:Drosophila_2:1629959_at:316:195; Interrogation_Position=333; Antisense; AACTGTGATCTATGTGCTGACCCGG
>probe:Drosophila_2:1629959_at:550:547; Interrogation_Position=372; Antisense; GGAGGCCGCCGATATTATGGCACCG
>probe:Drosophila_2:1629959_at:605:583; Interrogation_Position=389; Antisense; TGGCACCGCAGCAGAAGTCTCAAGT
>probe:Drosophila_2:1629959_at:456:595; Interrogation_Position=537; Antisense; TGTGGCGCCCATTAAATCGGTGATT
>probe:Drosophila_2:1629959_at:611:161; Interrogation_Position=612; Antisense; ACAATCTCCTGGCTATCACTATGAT
>probe:Drosophila_2:1629959_at:192:681; Interrogation_Position=631; Antisense; TATGATAGGCCCGATAGGTCCACAA
>probe:Drosophila_2:1629959_at:679:161; Interrogation_Position=654; Antisense; AATCTTGGCGCCAGTGGAACGAACT
>probe:Drosophila_2:1629959_at:523:723; Interrogation_Position=85; Antisense; TTGATTAGTCTGTCCTGGGCACAAG

Paste this into a BLAST search page for me
CAAGGATCGCGTTATTTACCACCACAAGCAGTTTTACAGCATATCACCCGATCACCCGCCGAAGATCCTGAGGATGAAACACTTGGTGATCGGACAGCCAGACAGCCACGCAGGAATTACCGAGTATATACGGCGGAGTTGGCACCTCAGAACTGTGATCTATGTGCTGACCCGGGGAGGCCGCCGATATTATGGCACCGTGGCACCGCAGCAGAAGTCTCAAGTTGTGGCGCCCATTAAATCGGTGATTACAATCTCCTGGCTATCACTATGATTATGATAGGCCCGATAGGTCCACAAAATCTTGGCGCCAGTGGAACGAACTTTGATTAGTCTGTCCTGGGCACAAG

Full Affymetrix probeset data:

Annotations for 1629959_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720