Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629960_s_at:

>probe:Drosophila_2:1629960_s_at:657:99; Interrogation_Position=128; Antisense; AGATGGCGCATCCATTGGGCAGCCA
>probe:Drosophila_2:1629960_s_at:172:727; Interrogation_Position=142; Antisense; TTGGGCAGCCAGTGCATCAGCGATT
>probe:Drosophila_2:1629960_s_at:270:35; Interrogation_Position=157; Antisense; ATCAGCGATTGCCTCGCCGAGAAGG
>probe:Drosophila_2:1629960_s_at:161:373; Interrogation_Position=177; Antisense; GAAGGGCAACCTAGTGCCGGATCAA
>probe:Drosophila_2:1629960_s_at:363:277; Interrogation_Position=187; Antisense; CTAGTGCCGGATCAACTGGGTGAAT
>probe:Drosophila_2:1629960_s_at:648:597; Interrogation_Position=211; Antisense; TGTCAGCAGGTCGAGCAGCAGTTCG
>probe:Drosophila_2:1629960_s_at:522:471; Interrogation_Position=231; Antisense; GTTCGACTGTACACTGTACTGCATG
>probe:Drosophila_2:1629960_s_at:33:349; Interrogation_Position=251; Antisense; GCATGTTTGATGTAGAGCCGCGCTA
>probe:Drosophila_2:1629960_s_at:394:415; Interrogation_Position=265; Antisense; GAGCCGCGCTATTAAGCCATTAACC
>probe:Drosophila_2:1629960_s_at:728:509; Interrogation_Position=296; Antisense; GTGCAAATACGCACAGGCTTGCTGG
>probe:Drosophila_2:1629960_s_at:489:71; Interrogation_Position=310; Antisense; AGGCTTGCTGGCCATTAAACCAATT
>probe:Drosophila_2:1629960_s_at:493:125; Interrogation_Position=328; Antisense; ACCAATTATGGCCAGGACCGTTGCA
>probe:Drosophila_2:1629960_s_at:421:573; Interrogation_Position=33; Antisense; GGCTGCACAGGCGATTGACCTTTCG
>probe:Drosophila_2:1629960_s_at:44:511; Interrogation_Position=89; Antisense; GTGCAGATGTGGCAGCCAGCTTAAA

Paste this into a BLAST search page for me
AGATGGCGCATCCATTGGGCAGCCATTGGGCAGCCAGTGCATCAGCGATTATCAGCGATTGCCTCGCCGAGAAGGGAAGGGCAACCTAGTGCCGGATCAACTAGTGCCGGATCAACTGGGTGAATTGTCAGCAGGTCGAGCAGCAGTTCGGTTCGACTGTACACTGTACTGCATGGCATGTTTGATGTAGAGCCGCGCTAGAGCCGCGCTATTAAGCCATTAACCGTGCAAATACGCACAGGCTTGCTGGAGGCTTGCTGGCCATTAAACCAATTACCAATTATGGCCAGGACCGTTGCAGGCTGCACAGGCGATTGACCTTTCGGTGCAGATGTGGCAGCCAGCTTAAA

Full Affymetrix probeset data:

Annotations for 1629960_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime