FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629962_at:

>probe:Drosophila_2:1629962_at:438:577; Interrogation_Position=1056; Antisense; GGCCGTTTCGCGATTGCATCAGATG
>probe:Drosophila_2:1629962_at:227:365; Interrogation_Position=1092; Antisense; GAAGAGCGACAACAGTTTCCGGAAA
>probe:Drosophila_2:1629962_at:572:521; Interrogation_Position=1157; Antisense; GTGGCGCCAACTGCTATGTCAATAG
>probe:Drosophila_2:1629962_at:671:61; Interrogation_Position=1222; Antisense; ATGTCCTTTGCATTTCTGAACCTAC
>probe:Drosophila_2:1629962_at:655:377; Interrogation_Position=1239; Antisense; GAACCTACTGTACTGGTGGGCCTAC
>probe:Drosophila_2:1629962_at:112:75; Interrogation_Position=722; Antisense; AGGACATCTGTATAGCCAACTCATT
>probe:Drosophila_2:1629962_at:73:313; Interrogation_Position=736; Antisense; GCCAACTCATTATCGGATCATGCCG
>probe:Drosophila_2:1629962_at:8:611; Interrogation_Position=786; Antisense; TGACGCCGACCCATTTGCGGATGAG
>probe:Drosophila_2:1629962_at:22:419; Interrogation_Position=876; Antisense; GAGCGGTGTCTGTGTATGCAACAAA
>probe:Drosophila_2:1629962_at:3:139; Interrogation_Position=902; Antisense; ACGATGCTCTCGGTCTGGAATATGA
>probe:Drosophila_2:1629962_at:655:435; Interrogation_Position=925; Antisense; GAGGTTTCGCTACAGAATTCACTAG
>probe:Drosophila_2:1629962_at:52:279; Interrogation_Position=946; Antisense; CTAGCTGGTGCTGGTTTTCTCAAAA
>probe:Drosophila_2:1629962_at:214:395; Interrogation_Position=971; Antisense; GAAATGCTATTTTTTGTCCCACATA
>probe:Drosophila_2:1629962_at:70:599; Interrogation_Position=985; Antisense; TGTCCCACATATAACGATCCATCGT

Paste this into a BLAST search page for me
GGCCGTTTCGCGATTGCATCAGATGGAAGAGCGACAACAGTTTCCGGAAAGTGGCGCCAACTGCTATGTCAATAGATGTCCTTTGCATTTCTGAACCTACGAACCTACTGTACTGGTGGGCCTACAGGACATCTGTATAGCCAACTCATTGCCAACTCATTATCGGATCATGCCGTGACGCCGACCCATTTGCGGATGAGGAGCGGTGTCTGTGTATGCAACAAAACGATGCTCTCGGTCTGGAATATGAGAGGTTTCGCTACAGAATTCACTAGCTAGCTGGTGCTGGTTTTCTCAAAAGAAATGCTATTTTTTGTCCCACATATGTCCCACATATAACGATCCATCGT

Full Affymetrix probeset data:

Annotations for 1629962_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720