Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629963_at:

>probe:Drosophila_2:1629963_at:248:525; Interrogation_Position=1827; Antisense; GGGCTTCCGCTCCAAAGTCAAATAG
>probe:Drosophila_2:1629963_at:538:307; Interrogation_Position=1860; Antisense; CCAGTGGGCTCAACTTCCAATTAGC
>probe:Drosophila_2:1629963_at:165:29; Interrogation_Position=1910; Antisense; ATACGGTTTAACTTCATGTGTGCAG
>probe:Drosophila_2:1629963_at:675:515; Interrogation_Position=1927; Antisense; GTGTGCAGTGGGTCGCTTAATGATT
>probe:Drosophila_2:1629963_at:369:657; Interrogation_Position=1944; Antisense; TAATGATTCGTCCATGTCGTGTGCC
>probe:Drosophila_2:1629963_at:400:291; Interrogation_Position=1961; Antisense; CGTGTGCCTTTTGTATGTGTCGACA
>probe:Drosophila_2:1629963_at:530:659; Interrogation_Position=1987; Antisense; TAAGCCGAAATCCACGTTGTTCAGG
>probe:Drosophila_2:1629963_at:197:661; Interrogation_Position=2028; Antisense; TAAATGTAATTTCCCGCCTAGCCTG
>probe:Drosophila_2:1629963_at:413:211; Interrogation_Position=2114; Antisense; AAGAAAGCTTTGAGCGCTGCGTCCT
>probe:Drosophila_2:1629963_at:156:505; Interrogation_Position=2134; Antisense; GTCCTCTTATCACTGCACAAGTTCA
>probe:Drosophila_2:1629963_at:705:553; Interrogation_Position=2173; Antisense; GGACGGACCGCCAAGTAATACTCTG
>probe:Drosophila_2:1629963_at:632:213; Interrogation_Position=2220; Antisense; AAGAGCGACGCGGAATCACTGGATA
>probe:Drosophila_2:1629963_at:261:717; Interrogation_Position=2248; Antisense; TTCCACGGCGGGTGCGTTAGTTAAT
>probe:Drosophila_2:1629963_at:228:567; Interrogation_Position=2322; Antisense; GGCAAATATATCCTGATCTCCCTAT

Paste this into a BLAST search page for me
GGGCTTCCGCTCCAAAGTCAAATAGCCAGTGGGCTCAACTTCCAATTAGCATACGGTTTAACTTCATGTGTGCAGGTGTGCAGTGGGTCGCTTAATGATTTAATGATTCGTCCATGTCGTGTGCCCGTGTGCCTTTTGTATGTGTCGACATAAGCCGAAATCCACGTTGTTCAGGTAAATGTAATTTCCCGCCTAGCCTGAAGAAAGCTTTGAGCGCTGCGTCCTGTCCTCTTATCACTGCACAAGTTCAGGACGGACCGCCAAGTAATACTCTGAAGAGCGACGCGGAATCACTGGATATTCCACGGCGGGTGCGTTAGTTAATGGCAAATATATCCTGATCTCCCTAT

Full Affymetrix probeset data:

Annotations for 1629963_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime