Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629964_at:

>probe:Drosophila_2:1629964_at:155:95; Interrogation_Position=1043; Antisense; AGAAATGGGTCCAGCCCTTGAGGCT
>probe:Drosophila_2:1629964_at:2:571; Interrogation_Position=1064; Antisense; GGCTTCAAATACACCTAACTCTGTT
>probe:Drosophila_2:1629964_at:302:375; Interrogation_Position=1107; Antisense; GAAGACTTTACACCTATGTTGGAAA
>probe:Drosophila_2:1629964_at:11:37; Interrogation_Position=1136; Antisense; ATCATCAGACCAAGTGCCGCGAGAA
>probe:Drosophila_2:1629964_at:286:667; Interrogation_Position=1184; Antisense; TACATCTAACTCAGAGCCTGCCAAG
>probe:Drosophila_2:1629964_at:24:225; Interrogation_Position=1206; Antisense; AAGGAAGATGGCTCCTCCGACGAAG
>probe:Drosophila_2:1629964_at:331:75; Interrogation_Position=1229; Antisense; AGGACCGGATGAAGAGCCCTTCCAG
>probe:Drosophila_2:1629964_at:547:303; Interrogation_Position=1246; Antisense; CCTTCCAGCGAGTGACCGAAACTAT
>probe:Drosophila_2:1629964_at:613:209; Interrogation_Position=1386; Antisense; AAGCAAACCCCGAACACTATGTTGT
>probe:Drosophila_2:1629964_at:390:367; Interrogation_Position=1422; Antisense; GAATCCGATATACGCCATGAAAGAA
>probe:Drosophila_2:1629964_at:133:613; Interrogation_Position=1439; Antisense; TGAAAGAAATGTCCTGCTGCAGTGC
>probe:Drosophila_2:1629964_at:176:617; Interrogation_Position=1456; Antisense; TGCAGTGCGTGCGACATGTTTGCGA
>probe:Drosophila_2:1629964_at:121:245; Interrogation_Position=1485; Antisense; AATTTCTTTGGCATTGGTCAAGCTA
>probe:Drosophila_2:1629964_at:247:465; Interrogation_Position=1551; Antisense; GTTGATTCAACACCGGATGCATTAT

Paste this into a BLAST search page for me
AGAAATGGGTCCAGCCCTTGAGGCTGGCTTCAAATACACCTAACTCTGTTGAAGACTTTACACCTATGTTGGAAAATCATCAGACCAAGTGCCGCGAGAATACATCTAACTCAGAGCCTGCCAAGAAGGAAGATGGCTCCTCCGACGAAGAGGACCGGATGAAGAGCCCTTCCAGCCTTCCAGCGAGTGACCGAAACTATAAGCAAACCCCGAACACTATGTTGTGAATCCGATATACGCCATGAAAGAATGAAAGAAATGTCCTGCTGCAGTGCTGCAGTGCGTGCGACATGTTTGCGAAATTTCTTTGGCATTGGTCAAGCTAGTTGATTCAACACCGGATGCATTAT

Full Affymetrix probeset data:

Annotations for 1629964_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime