FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629965_at:

>probe:Drosophila_2:1629965_at:395:579; Interrogation_Position=1022; Antisense; TGGCCAAGCCCAACACCGAGAAGAG
>probe:Drosophila_2:1629965_at:492:135; Interrogation_Position=1058; Antisense; ACGAGCTGGCGCTGAAATACTTGCG
>probe:Drosophila_2:1629965_at:491:241; Interrogation_Position=1073; Antisense; AATACTTGCGCCAGCCAGTGGATGA
>probe:Drosophila_2:1629965_at:502:373; Interrogation_Position=1131; Antisense; GAAGTCCCCTAATCCAGAGCCACTG
>probe:Drosophila_2:1629965_at:309:145; Interrogation_Position=1152; Antisense; ACTGCGTCCGATCGACAACATAGGC
>probe:Drosophila_2:1629965_at:521:679; Interrogation_Position=1172; Antisense; TAGGCCACGCGCAGAGTCCAAACGA
>probe:Drosophila_2:1629965_at:82:401; Interrogation_Position=1195; Antisense; GACATATCCAATGCTTCGTACAAGT
>probe:Drosophila_2:1629965_at:218:181; Interrogation_Position=1226; Antisense; AAAAATACCGTCTGCTGCCCGAGGA
>probe:Drosophila_2:1629965_at:324:517; Interrogation_Position=1264; Antisense; GTGTGTCCACAATCTCCCATGGCGG
>probe:Drosophila_2:1629965_at:502:243; Interrogation_Position=1327; Antisense; AATATCAGGAACCAGCCGAAGCTGT
>probe:Drosophila_2:1629965_at:147:115; Interrogation_Position=846; Antisense; AGCAGGTAGACGCTTGTCTCCCATT
>probe:Drosophila_2:1629965_at:492:343; Interrogation_Position=857; Antisense; GCTTGTCTCCCATTATGCAGGATTA
>probe:Drosophila_2:1629965_at:492:111; Interrogation_Position=918; Antisense; AGCACGAGTGATTCCTCAGTTTCCG
>probe:Drosophila_2:1629965_at:728:245; Interrogation_Position=970; Antisense; CAATCTACGGGCTACCGGGCCAATA

Paste this into a BLAST search page for me
TGGCCAAGCCCAACACCGAGAAGAGACGAGCTGGCGCTGAAATACTTGCGAATACTTGCGCCAGCCAGTGGATGAGAAGTCCCCTAATCCAGAGCCACTGACTGCGTCCGATCGACAACATAGGCTAGGCCACGCGCAGAGTCCAAACGAGACATATCCAATGCTTCGTACAAGTAAAAATACCGTCTGCTGCCCGAGGAGTGTGTCCACAATCTCCCATGGCGGAATATCAGGAACCAGCCGAAGCTGTAGCAGGTAGACGCTTGTCTCCCATTGCTTGTCTCCCATTATGCAGGATTAAGCACGAGTGATTCCTCAGTTTCCGCAATCTACGGGCTACCGGGCCAATA

Full Affymetrix probeset data:

Annotations for 1629965_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720